CHE106 DNA WORKSHEET
Name _______________________________________________
1. Match with the word bank. Each word is used once.
DNA polymerase
mtDNA
mitochondria
nucleotides
trillions
zero
two
two
72 degrees
55 degrees
94 degrees
nucleus
3 billion
thirteen
2 meters
chromosome
______________ location of DNA in human cells
______________ number of cells in a human body
______________ length of DNA in a single cell
______________ a strand of DNA, human cells have 46
______________ building blocks of the DNA polymer
______________ number of bases in a human genome (a single human cell)
______________ number of strands of DNA in a DNA molecule
______________ enzyme that copies DNA strand to form a new DNA strand
______________ temperature at which DNA denatures (strands separate)
______________ temperature at which DNA primers anneal (attach) to template DNA
______________ temperature at which Taq DNA polymerase synthesizes new DNA
______________ number of Y chromosomes in a human female
______________ number of X chromosomes in a human female
______________ cellular organelles that have their own (non-nuclear) DNA
______________ has a region useful for distinguishing individuals and DNA more stable than nuclear DNA
______________ number of STRs used by the CODIS identification system
2. Start with 2 nanograms (2 X 10 – 9 grams) of DNA. Perform the PCR for 7 cycles. How much DNA has
been synthesized?
3. Fill in the complementary strands initiated by the primers in the PCR
AATAAGGCGGATTACTAGAATTCTCTA
TTATTCC
 TTCTCTA
TTATTCCGCCTAATGATCTTAAGAGAT
4. Norma has inherited 15 copies of a 6 base STR from her mother and 8 copies of the same STR from her
father. She is characterized as 15, 8. When a DNA fingerprint is performed using the PCR, what size
DNA bands will result?
1
CHE106 DNA WORKSHEET
5. Locate the STR in the following DNA sequence.
A. How many repeats are present?
B. If this STR was PCR-amplified, how many bases would the product be (how big)?
gatagaacac ttgtcatagt ttagaacgaa ctaacgatag atagatagat agatagatag atagatagat agatagatagtttt tttttatctc
actaaatagt ctatagtaaa catttaatta
6. View the karyotype of chromosomes. Male or female? How do you know?
6. Fill in with the appropriate term. Some terms may be used more than once
Homologous
Phenotype
Dominant
Genotype
Heterozygous
Homozygous recessive
Co-dominant
_______________Chromosomes that have the same length and the same genes
_______________The genetic make-up of an individual
_______________An Hh genotype
_______________Person who has one dominant allele and one recessive allele for a trait
_______________Person with two recessive alleles for eye color
_______________The appearance of a person
_______________An allele that masks the expression of another allele
_______________Two alleles, each expressed equally in the phenotype
_______________The A and B blood group antigen alleles
_______________Genotype of a person with blue eyes
_______________Genotype of a person with Type O blood
7. Mate a woman with the genotype AO with a man with a genotype OO.
A. What is the blood type of the woman and the man?
B. What possible blood types might their offspring exhibit in the phenotype?
C. What percent of the offspring are expected to have each phenotype?
2
CHE106 DNA WORKSHEET
Review questions Unit 3
1. What is forensic entomology?
2. What are the characteristics of arthropods? Provide examples.
3. What are the characteristics of insects? Provide examples.
4. What are the 4 stages of insect metamorphosis?
5. How are maggots used to determine the post mortem interval?
6. What types of insects feed on a corpse?
7. How do weather conditions, CO2, burial depth, and water affect the fly life cycle?
8. What are some of the animals that feed on a corpse submerged in water?
9. What tissues do the following prefer to eat in decomposing tissue: raccoons, rats, birds, coyotes?
10. How can plant pollen and/or DNA be used to link a suspect to a crime?
11. How can the ingested material of maggots be used to determine the type of explosive residue or if a
gunshot wound occurred? Why might it more useful to test maggots than the body itself?
12. How can plants around a skeleton be used to determine the age of a murder?
13. Where is DNA located in cells?
14. What are the functions of DNA?
15. What does DNA stand for?
16. How many chromosomes are in a human nucleus?
17. Why are the chromosomes in pairs?
18. What is a gene?
19. Who discovered the structure of DNA?
20. What are the building blocks of DNA?
21. What type of bonds are between complementary bases in DNA? What is complementary base pairing?
22. How does DNA fingerprinting allow one to distinguish between two individuals?
23. What is the difference between fraternal and identical twins with respect to DNA?
24. What is the polymerase chain reaction?
25. How many cycles of PCR are required to obtain enough DNA for analysis?
26. What are applications of DNA fingerprinting: forensics, conservation, paternity, medicine and military?
27. Where is tissue for DNA fingerprinting often obtained from?
28. What is a DNA polymorphism? A short tandem repeat (STR)?
29. What does a 7,8 profile refer to?
30. What is the name of the technique that separates DNA fragments based on size?
31. How can DNA fingerprinting be used to exonerate people?
32. What does CODIS contain?
33. How was DNA fingerprinting used in the Clinton/Lewinsky investigation?
34. How was DNA fingerprinting used in the 911 disaster?
35. What happens to sperm and egg chromosomes during fertilization?
36. Which parent determines the sex of the offspring?
37. What are dominant and recessive alleles?
38. What is a homozygous dominant, heterozygous, and homozygous recessive genotype? How are they
symbolized?
39. What is serology?
40. What is the function of red blood cells, white blood cells, and platelets?
41. What are the A, B, and O blood group alleles?
42. What is meant by an A+ or B- blood type?
43. How is the chance of having a child of a particular blood type calculated by using information on the
parents’ blood types?
3