01-05-09
Protocol for cloning crosslinked RNAs
TEV cleavage:
1.
2.
3.
4.
Wash IgG beads twice with TNM1000 and twice with TNM150
Resuspend washed beads in 600 µl of 150
Add 20 units of GST-TEV protease (2 µl of old prep, 12 µl of new prep)
Incubate beads at 18ºC for two hours with constant shaking
RNAse treatment and Nickel purification
1. To 500 µl of (cross-linked) TEV eluate, add RNace it (try 1, 0.5 or 0.1 units of RNaceIt
per reaction). The incubation time required to partially digest the RNA needs to be
empirically determined for each RNA and protein. I usually do 5-10 minutes at 37ºC.
2. Add 0.4 g of Guanidium-HCl (~ 0.5 ml of powder; final concentration is 6M), vortex.
Final volume should be around 700 µl. I usually just transfer the TEV eluates to a tube
containing the Guanidium powder. Vortex well to dissolve the Guanidium. At this stage,
you don't really have to keep the tubes on ice anymore. The Guanidium will then protect
the RNA from further degradation. The Guanidium will increase the pH to ~8.2. Make
sure that the pH of your Tris buffer is exactly 7.8!!
3. To each tube, add 27 µl 5M NaCl (final [NaCl] = 300 mM) and 3 µl 2.5M Imidazole (pH
8.0) (final concentration = 10 mM).
4. Mix the solution and add to 50 µl of Nickel beads, pre-equilibrated in wash buffer I
5. Nutate 2 hours or o/n at 4ºC.
6. Wash beads twice with 750 µl wash buffer I three times with 750 µl 1x PNK buffer
7. Transfer beads to mobicol spin columns
Alkaline phosphatase treatment of preciptated RNAs
Treating the RNAs with alkaline phosphatase will remove the 3’ phosphates left behind by the
RNase cleavage of the RNA.
1. Spin out the remaining buffer and add the following mix:
5 x PNK buffer
*TSAP/ CIP
RNasin
MQ
Ve
1x
16 µl
8 µl
2 µl
54µl
80 µl
6x
96 µl
48 µl
12 µl
324µl
480 µl
10x
160 µl
80 µl
20 µl
540 µl
800 µl
2. Incubate the beads 30 minutes at 37ºC
3. Wash the beads once with 400 µl wash buffer I (to make sure that the TSAP is
inactivated) and then three times with 400 µl 1x PNK buffer
* The alkaline phosphatase is from Promega and according to the Tech Department does NOT
contain a HIS6-tag (CAT# M9910; 100 units). Furthermore, this phosphatase is specially
designed to work in almost all restriction enzyme buffers and should therefore work well in 1x
PNK buffer, which is similar to Promega’s buffer G.
Sander Granneman
1
01-05-09
On-bead ligation of the miRCat-33 or Solexa 3’ linker to the 3' end of the RNA
The DNA oligos used in this ligation reaction has a blocked 3’ (ddC) end and an activated
adenosine at the 5’ end. These linkers can be ligated to the RNA substrate in the absence of
ATP. In this case, the RNAs should not ligate to itself but only to the linker. The 3’ linker is in
vast excess (1 µM) over RNA and less could probably be used, this part could be further
optimized. These concentrations are, however, already four fold lower than recommended in the
CLIP protocol.
1. Spin out the remaining buffer and add 80 µl of the following mix:
5 x PNK buffer
miRCat-33/Solexa linker (10 µM)
T4 RNA ligase (NEB)
RNasin
MQ
Ve
1x
16 µl
8 µl
4 µl
6x
96 µl
48 µl
24 µl
2 µl
50 µl
80 µl
10x
160 µl
80 µl
40 µl
12 µl
300 µl
480 µl
20 µl
500 µl
800 µl
2. Incubate the reaction for 6 hours at 25ºC (could possibly be reduced to 2 hours)
3. Wash beads once with 400 µl of wash buffer I and three times with 400 µl 1x PNK
buffer
Phosphorylating the 5’ ends of the RNA and gel electrophoresis
1. Spin out the remaining buffer and add 80 µl of the following mix:
5 x PNK buffer
32
P-ATP (10 µCi/ µl)
T4 PNK (Sigma, 5U/µl)
MQ
Ve
1x
16 µl
4 µl
4 µl
56 µl
80 µl
6x
96 µl
24 µl
24 µl
336 µl
480 µl
10x
160 µl
40 µl
40 µl
560 µl
800 µl
1. Incubate the reaction for 40 minutes at 37ºC.
2. Add 1 µl 100 mM ATP and let the reaction proceed for another 20 minutes. This will
make sure that almost all of the 5’ ends have phosphates.
3. Wash beads once with 400 µl of wash buffer I and three times with 400 µl 1x PNK
buffer
Sander Granneman
2
On-bead ligation of the 5’ linker
The Solexa 5’ linker is a DNA-RNA hybrid, which has an inverted ddT at the 5’ end to block
multimerization of the oligo during the ligation reactions. This should not happen in theory but
we have seen it with other oligos. The 5’ linker here is present in enormous excess and less
could probably be used, this part could be further optimized.
1. Spin out the remaining buffer and add 76 µl of the following mix:
5 x PNK buffer
ATP (10 mM)
Solexa 5’ linker (100 µM)
RNasin
MQ
Ve
1x
16 µl
8 µl
1 µl
6x
96 µl
48 µl
6 µl
2 µl
49 µl
76 µl
10x
160 µl
80 µl
10 µl
12 µl
294 µl
456 µl
20 µl
490 µl
760 µl
2. Add 4 µl of T4 RNA ligase (NEB) to each tube and incubate o/n at 16ºC
3. Wash the beads three times with 400 µl of wash buffer II.
4. Spin out the void volume and elute with wash buffer II containing 150 mM Imidazole
(incubate beads with 200 µl of elution buffer, twice for 5 minutes)
5. Add 2 µg of BSA to each sample and TCA precipitate the eluates (40’ ice), wash pellet
with Acetone and resuspend in 30 µl of 1x NuPAGE buffers. Load on a 1.5 mm thick
NuPage 4-12% gradient gel. This gel system is absolutely essential since the pH
remains roughly 7.0 during the run. You can’t use the “normal” SDS-PAGE gels because
the pH can go up to 9, leading to hydrolysis of your RNA
6. Transfer the proteins to nitrocellulose membrane using the wet transfer system and the
buffer supplied by Invitrogen. Transfer the proteins for 1.5 hours at 100V.
7. Expose a film (one hour in -80 with screen is normally enough but sometimes o/n is
required)
8. Cut out the bands corresponding to the size of your protein + the expected MW of your
RNA (in this case you’ve already figured out the average size of your RNA after RNaceIT digestion. Incubate the membrane slices with 400 µl of wash buffer II containing 1%
SDS and 5 mM EDTA and add 100 µg of Proteinase K.
9. Incubate for 2 hours at 55ºC
10. Add 50 µl of 3M NaAc pH 5.2 and 500 µl of PCI and precipitate the RNA with 1 ml of
EtOH and 20 µg of glycogen. Incubate in -80 for half an hour
11. Precipitate the RNA in a centrifuge and wash pellet with 70% EtOH and air-dry.
TCA precipitation
1. Add 2 µg of BSA to each eluate (2 µl of 1 mg/ml BSA solution in wash buffer II)
2. To 400 µl of nickel eluate, add 100 µl of 100% Trichloroacetic acid (TCA), vortex and let
sit 30 min - 1 hour at 4ºC (preparation of 100% TCA: 454 ml H2O/kg TCA. Maintain in
dark bottle at 4ºC. Be careful, use gloves!!!).
3. Spin 30 min 4ºC in microcentrifuge at maximum speed. Carefully discharge supernatant
and retain the pellet.
4. Add 800 µl of acetone (stored in -20ºC freezer) and spin 20 minutes at full speed in
eppendorf centrifuge.
5. Dry samples under vacuum (speed vac) or air-dry.
Reverse transcription protocol
1. Reaction mix: resuspend the RNA pellet in the following mix:
MQ
RT oligo (10 µM)
5 mM dNTP mix (FRESH!)
Ve
1x
10 µl
1 µl
2 µl
13 µl
6x
60 µl
6 µl
12 µl
78 µl
2. Heat mixture to 80ºC for 3 minutes and snap chill on ice for 5 minutes. Collect the
contents by brief centrifugation and add 6 µl of the following mix:
5 x first strand buffer
100 mM DTT
RNasin (40 units/µl)
Ve
1x
4 µl
1 µl
1 µl
6 µl
6x
24 µl
6 µl
6 µl
36 µl
3. Incubate the mixture at 50ºC for three minutes and then add 1 µl of Superscript III and
incubate the reaction for one hour at 50ºC
4. Inactivate Superscipt III by incubation at 65ºC for 15 minutes
5. Add 2 µl of RNase H (NEB) and incubate for 30 minutes at 37ºC
6. Use 1µl of the RT reaction for PCR
PCR reaction
10 x LA Taq buffer
10 µM Forward primer
10 µM Reverse primer
5 mM dNTPs (fresh!)
LA Takara Taq
Ligation reaction
MQ
Ve
Program:
95 ºC 2 min
1x
5 µl
1 µl
1 µl
2.5 µl
0.5 µl
1 µl
39 µl
50 µl
10x
50 µl
10 µl
10 µl
25 µl
5 µl
(5 µl)
390 µl
500 µl
98 ºC 20 sec
52 ºC 20 sec
68 ºC 20 sec
25-30 cycles (this needs to be carefully controlled as you don’t want to
“over amplify”. Use your negative control also as a negative control in
PCR.
72 ºC 5 min
CRAC Cloning with TOPO Kit
PCR:
1. Do 3 TAKARA PCR reactions per cDNA sample
2. Pool the PCR reactions and purify the product using the Qiagen PCR purification kit but
with minielute columns. Elute DNA in 20 µl of water of elution buffer.
3. Prepare 3% Metaphore agarose gel while PCR is running, takes a while: soak agarose in
TBE for 30 min on ice and then heat in microwave (will make lots of foam) pour carefully
and remove bubbles.
4. What I’ve also done is boil 1xTBE in microwave and slowly added the agarose. It took
about half an hour to get everything dissolved. Don’t make the gels too thick!
5. When the gel is set, put it at 4°C until samples are ready (at least 30 min) run
bromphenolblue band to the bottom
6. Gel purify fragments (select bands with expected insert size between 12-30 bp) using the
Qiagen MINI elute kit and elute the DNA in 20 µl of MQ
TOPO TA cloning:
Purified PCR product 2µl
Salt solution
pCR4 TOPO Vector
MQ to 6µl total volume
1µl
1µl
2. mix and ligate at RT for 5 min (up to 30 min possible); put on ice
3. take 2µl of ligation and add it to 1 vial of one shot TOP10 (invitrogen) and mix
gentely, very delicate cells
4. leave on ice for 15 min
5. heat shock for 30 sec 42°C
6. on ice for 5 min
7. add 250µl SOC medium (RT)
8. shake for 1 hr at 37°C
9. plate everything on LB Amp (or Kanamycin which is more stringent)
Oligonucleotides:
Solexa 3’ pre-activated, adenylated cloning linker:
Sequence:
5'-rAppTCGTATGCCGTCTTCTGCTTGT/ddC/-3'
Solexa 5’ linker
Sequence:
5’-/5InvddT/GTTCArGrArGrUrUrCrUrArCrArGrUrCrCrGrArCrGrArUrC-3’
Solexa RT
Sequence:
5’-CAAGCAGAAGACGGCATAC-3
Solexa PCR Forward
Sequence:
5’-AATGATACTGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA-3’
Solexa PCR Reverse
Sequence:
5’-CAAGCAGAAGACGGCATACGA-3’
miRCat-33™ 3′ pre-activated, adenylated cloning linker:
Sequence:
5’- rAppTGGAATTCTCGGGTGCCAAGG/ddC/-3’ (22 nt; IDT; Tm =64ºC)
miRCat-33™ PCR oligo: (use for RT)
Sequence:
5’- CCTTGGCACCCGAGAATT-3’ (Tm =52ºC)
CRAC-reverse (3’ PCR):
Sequence:
5’-GCCTTGGCACCCGAGAATTCC-3’ (HPLC purified; Tm = 61ºC)
RL5 (5’ linker):
Sequence:
5’-rArGrGrGrArGrGrArCrGrArUrGrCrGrG-3’ (16 nt; Dharmacon; gel purified)
DP5 (5’ PCR):
Sequence:
5’-AGGGAGGACGATGCGG-3’ (HPLC purified; Tm=51ºC)
Buffers
TNM150 buffer:
50 mM Tris-HCl pH 7.8
150 mM NaCl
1.5 mM MgCl2
0.1% NP-40
5 mM beta-mercaptoethanol (add fresh)
TNM1000 buffer:
50 mM Tris-HCl pH 7.8
1 M NaCl
1.5 mM MgCl2
0.1% NP-40
5 mM beta-mercaptoethanol (add fresh)
1 x PNK buffer:
50 mM Tris-HCl pH 7.8
10 mM MgCl2
0.5% NP-40
5 mM beta-mercaptoethanol (add fresh)
5 x PNK buffer:
250 mM Tris-HCl pH 7.8
50 mM MgCl2
50 mM beta-mercaptoethanol
(store at -20ºC)
Wash buffer I:
50 mM Tris-HCl pH 7.8
300 mM NaCl
10 mM Imidazole
6M Guanidine-HCl
0.1% NP-40
5 mM beta-mercaptoethanol (add fresh)
Wash buffer II:
50 mM Tris-HCl pH 7.8
50 mM NaCl
10 mM Imidazole
0.1% NP-40
5 mM beta-mercaptoethanol (add fresh)
Elution buffer:
50 mM Tris pH 7.8
50 mM NaCl
150 mM Imidazole
0.1% NP-40
5 mM beta-mercaptoethanol (add fresh)
Other solutions:
2.5 M Imidazole pH 8.0
100 mM ATP
10 mM ATP
Proteinase K
prepare 20 mg/ml solution in water (make fresh)