CVR-2010-1018R2
SUPPLEMENTAL MATERIAL
MATERIALS AND METHODS
Chemicals and materials.
Doxorubicin (DOX) was purchased from Bedford Laboratories. Collagenase II was
purchased from Worthington Biochemical Corporation (Lakewood, NJ). 2-Methyl-2H-pyrazole-3carboxylic acid-(2-methyl-4-o-tolyl-azophenyl)-amide (CH-223191), an aryl hydrocarbon
receptor (AhR) antagonist was purchased from Calbiochem (San Diego, CA). CelLytic-M, antiporin antibody, N,N′-dimethyl-9,9′-biacridinium dinitrate (lucigenin) and 2,3,7,8tetrachlorodibenzodioxin (TCDD) were purchased from Sigma-Aldrich (St. Louis, MO).
Dulbecco’s modified Eagle’s medium (DMEM) with high glucose, medium 199, penicillin,
streptomycin, fetal bovine serum (FBS), mouse laminin, Platinum SYBR Green qPCR kit,
precast polyacrylamide gels were purchased from Gibco-Invitrogen (Carlsbad, CA). PVDF
membrane was purchased from Millipore (Billerica, MA). Protein A/G PLUS-agarose, antibodies
against actin, β-tubulin, AhR, and cytochrome CYP1A1, secondary HRP-conjugated antibodies,
rat specific AhR siRNA and scrambled siRNA were purchased from Santa Cruz Biotechnology
(Santa Cruz, CA). Antibodies against ARNT1 and HSP90 were purchased from Cell Signaling
Technology (Beverly, MA). Anti-TATA-binding protein (TBP), anti-GSTA1, anti-phosphoserine
46-p53 and anti-p53 antibodies were purchased from Abcam Inc. (Cambridge, MA). Biotin 3'
End DNA Labeling Kit, LightShift Chemiluminescent EMSA Kit, Biodyne B Nylon Membrane for
Chemiluminescent EMSA, Super Signal West Pico Chemiluminescent substrate and Restore
Western Blot stripping buffer were purchased from Pierce (Rockford, IL). FuGene 6, Cytotoxicity
Detection Kit (LDH) and EDTA-free protease inhibitor cocktail were purchased from Roche
(Germany). RNA and DNA isolation kits were purchased from Qiagen (Valencia, CA). iScript
cDNA synthesis kit was purchased from Bio-Rad (Hercules, CA). DNA laddering kit was
purchased from Maxim Biotech Inc. (San Francisco, CA).
Animals
1
CVR-2010-1018R2
AhR-/- mice (provided by Frank Gonzalez, PhD, National Cancer Institute, Bethesda,
MD) and C57BL control mice (Jackson Labs, Bar Harbor, ME), 8 weeks old, weighing 20-23g,
were housed under controlled conditions (12 h light-dark cycle, 22°C, 60% humidity). They were
fed a standard rodent chow ad libitum and had free access to water. All studies conform to the
Guide for the Care and Use of Laboratory Animals published by the US National Institutes of
Health (NIH Publication No. 85-23, revised 1996).
Cell line
The H9C2 cell line was purchased from ATCC (Manassas, VA). Cells were maintained
at 37°C in a 5% CO2 atmosphere. Cells underwent serial passage (up to passage 15) in DMEM
containing high glucose, 100 IU/ml penicillin, 100 µg/ml streptomycin and 10% FBS. Before all
experiments, cells were starved overnight in medium containing 3% FBS.
Isolated adult rat ventricular myocytes (ARVM)
Primary adult rat cardiomyocytes were isolated using a collagenase perfusion method
with stepwise increases in the Ca2+ concentration. Briefly, adult male Sprague Dawley rats, 150220 g (Charles River Laboratory, Raleigh, NC) were anesthetized with pentobarbital and
heparinized, the heart was quickly removed and immediately perfused at 37°C with the following
media: medium A (6mM KCl, 1mM NaH2PO4, 1.4 mM MgSO4, 128mM NaCl, 10mM NaHEPES,
5.5 mM glucose, 2mM pyruvate, 5 min), medium B (Medium A plus 0.7% BSA fraction V, 1.1
mg/ml collagenase, 15 mM 2,4-butanedione monoxime, 15 min). Calcium chloride (10 mM) was
added serially over a 10-minute period to a final concentration of 100 µM. The heart was taken
off the cannula, placed in a culture dish containing 25 ml of medium B and 25 ml of medium C
(Medium A plus 100 µM CaCl2, 2% BSA fraction V), carefully torn open and immediately
transferred to a prewarmed 250-ml flask at 37°C). Heart tissue was shaken for 20 min at 180
strokes/min in an atmosphere of 95% O2/ 5% CO2. The calcium concentration was increased
stepwise up to a final concentration of 1 mM by 4 additions of 100 mM CaCl2 at 13.0, 14.5, 16.0
and 17.5 min. The heart tissue was filtered through a nylon net (mesh size: 200x200 µm) and
2
CVR-2010-1018R2
centrifuged. The pellet containing cardiomyocytes was resuspended in resting medium (Medium
199, 100 IU/ml penicillin, 100 μg/ml streptomycin and 10% FBS) and plated on 100-mm tissue
culture plates (5x105 cells/plate) precoated with mouse laminin (1.42 μg/cm2). After 2-3 hours,
the resting medium was carefully replaced with similar medium containing 1% FBS overnight.
DOX and AhR antagonist treatments
Mice were injected with a single intraperitoneal dose of DOX (10 mg/kg) or saline
(control group) and sacrificed after 4 hours, 24 hours or 2 weeks. Hearts were removed and
freeze clamped for subsequent analyses. Frozen heart tissue was homogenized in appropriate
buffer according to Qiagen protocols for RNA or DNA isolation. The remaining frozen heart
tissue was homogenized in lysis buffer containing 20 mM HEPES, pH7.4, 50 mM β-glycerol
phosphate, 2 mM EGTA, 1 mM DTT, 1 mM NaVO4, 1% Triton X-100 and 10% glycerol. The
homogenate was centrifuged at 800g for 15 min. The supernatant containing the cytosolic
fraction was carefully transferred into a different tube and the pellet containing nuclei was
resuspended in two volumes of nuclear protein isolation buffer (20 mM HEPES pH 7.9, 25%
glycerol, 0.42 M NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, EDTA-free protease inhibitor cocktail, 1
mM NaVO4, 0.5 mM DTT) and placed at 4°C on a rocker overnight. The suspension was
centrifuged for 30 min at 10,000g and the supernatant was kept for nuclear protein analysis.
For H9C2 cells and ARVM, DOX was added at a concentration of 2.5 μM and incubated
for 4, 6 or 24 hours. CH-223191 was dissolved in DMSO according to the manufacture’s
instruction and single experiment aliquots were prepared and frozen at -20°. The AhR
antagonist was added to the ARVM at a concentration of 10 μM. After the experiment, cells
were harvested on ice using Cellytic-M solution, and the lysate was passed at least 5 times
through a 25-gauge needle and centrifuged at 800g for 15 min. The nuclei-containing fraction
was isolated as described above. To isolate DNA or RNA, cells were trypsinized and harvested,
and nucleic acids were isolated according to Qiagen protocols.
Echocardiographic assessment of left ventricular function
3
CVR-2010-1018R2
Echocardiographic assessment of left ventricular systolic function was performed using a
40-MHz probe and a Vevo 770 Utrasound system. The mice were lightly anesthetized with 0.51.0% isoflurane and a depilatory was applied to the chest. Two-dimensionally guided M-mode
images of the left ventricle were acquired along the long and short axes to assess left
ventricular fractional shortening.
siRNA knockdown of AhR in H9C2 cells
The transfection was performed in 60-mm tissue culture plates. For a 100-μl total
volume, 6 μl of Fugene 6 was added to transfection medium (high glucose DMEM without FBS
or antibiotics) and incubated for 5 min. AhR or scrambled siRNA (80 pmol) was added to the
solution and incubated for and additional 30 min. Growth medium was aspirated from plates
(60-75% confluency) and plates were washed once with 2 ml of transfection medium. One
milliliter of transfection medium containing 1% FBS was added to 100 μl of siRNA-FuGene
mixture, mixed gently and overlaid onto the washed cells. After 6 hours, 1 ml of high glucose
medium containing 20% FBS and 200 μg penicillin/streptomycin was added to the plate. Cells
were incubated for 24 more hours before DOX or saline was added.
Q-PCR analysis
cDNA was synthesized from 300 ng of total RNA using an iScript cDNA synthesis cDNA
kit with random oligonucleotides. Q-PCR for all genes was performed using the SYBRGreen
protocol. 18S RNA was used as the reference gene. The PCR conditions were: 95°C for 5 min,
50 cycles of 95°C for 30 sec, 60°C for 30 sec, 72°C for 30 sec. All PCR primers are presented
in SUPPL Table 1. For each previously unpublished primer pair, a standard curve was prepared
from cDNA dilutions to ensure the maximum reaction efficiency, and a melting curve was
generated to confirm the absence of non-specific products. All data are represented as –ΔCt =
-(Ct target-Ct18S). Fold difference in gene expression between control and DOX treatment was
defined as 2-ΔΔCt.
Protein Immunoprecipitation and Western Immunoblotting.
4
CVR-2010-1018R2
For AhR immunoprecipitation, 100 µg of protein lysate, 1 μg of goat IgG and 40 μL of
Protein A/G Plus agarose were added to dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM
EDTA, 16.7 mM Tris-HCl, pH8.1, 167mM NaCl), and placed on rocking platform for 1 hour.
Samples were then centrifuged at 800g for 1 min, the supernatant was transferred to another
tube containing 1 μg anti-AhR antibody, and placed on a rocking platform at 4°C overnight.
Protein A/G Plus agarose (60 μL) was added to each sample and incubated on a rocking
platform for another hour. The agarose beads were pelletted by brief centrifugation at 800g and
the supernatant was removed. Protein A/G agarose-antibody/protein complex was washed 5
times by resuspending the beads in 1 ml each of the following buffers in the order A-D and
incubated for 4 min on a rocking platform followed by brief centrifugation and careful removal of
the supernatant fraction: Buffer A – 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl,
pH8.1,150 mM NaCl; Buffer B –500 mM NaCl, 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20
mM Tris-HCl, pH8.1; Buffer C – 0.25 mM Lick, 1% IGEPAL-CA630, 1% exilic acid, 1 mM EDTA,
10 mM Tris-HCl, pH8.1; Buffer D – TE buffer. After the last wash, beads were pelletted, the
supernatant was removed and 10 μL of 6x loading buffer was added to the pellet. Before
applying to the gel, each sample was boiled for 5 min.
Immunoblots were run on precast NuPage gels. AhR, ARNT and HSP90 were run on 35% Tris-acetate gels, CYP1A1 was run on 10% Bis-Tris gels, and GSTA1 was run on 12% BisTris gels according to the protocol provided by Invitrogen. Proteins were transferred to PVDF
membrane, pretreated with methanol, in Tris-Glycine transfer buffer (25 mM Tris, 192 mM
glycine and 20% methanol) at 250 mA for 1 h 15 min. Membranes with transferred proteins
were preincubated for 1 hour in 5% milk or 5% BSA solution in TBS buffer containing 0.1%
Tween-20 (TBST) and then incubated with appropriate antibody overnight at 4°C. Membranes
were washed 3 times in TBST buffer for 15 min, incubated with appropriate HRP-conjugated
secondary antibody (1:2500) at room temperature for 1 hour, washed 3 more times for 15 min
and detected with chemiluminescent substrate. For stripping, the membranes were washed for
5
CVR-2010-1018R2
15 min at room temperature with Restore Western Blot stripping buffer. Followed by two
washes with TBST buffer for 15 min, membranes were preincubated in 5% milk solution in
TBST buffer for an hour and incubated with appropriate antibody overnight at 40C.
Electrophoretic Mobility Shift Assay (EMSA).
To perform EMSA, a LightShift Chemiluminescent EMSA Kit was used. A fragment of
the CYP1A1 promoter containing an XRE-binding site 1 was biotin labeled. A 100-bp fragment
was amplified by PCR from rat genomic DNA (for primer structures see SUPPL Table 1) and the
structure was verified by direct sequencing. To obtain a large amount of target fragment, it was
cloned into the pGEM T-easy plasmid vector, which was grown in One Shot TOP10 Chemically
Competent cells. Plasmid was isolated using a MAXI prep kit and the target promoter sequence
was retrieved by incubating plasmid with EcoRI restriction enzyme. Purified fragment containing
the XRE binding site was labeled with biotin using a Biotin 3' End DNA Labeling Kit. Briefly, 3
µM CYP1A1 promoter fragment was mixed with TdT reaction buffer, 5 µM biotin-11-dUTP and
0.2 U/µl TdT and subsequently incubated at 37°C for 30 min. The reaction was stopped with
EDTA and TdT was extracted using chlorophorm:isoamyl alcohol mix. Labeling efficiency was
verified by dot blot analysis.
To perform the DNA-protein binding reaction, the LightShift EMSA Optimization Kit was
used. The binding reaction was run under three conditions: (1)without protein extract , (2)
sufficient nuclear protein to cause binding and shift the biotin labeled CYP1A1 promoter
fragment and (3) sufficient protein target and an excess of unlabeled CYP1A1 fragment. To
demonstrate that AhR is the protein responsible for the shift, samples were also run with nuclear
protein and 2 µg of anti-AhR antibody. Biotin labeled CYP1A1 promoter fragment was mixed
with the binding buffer, 50 ng/µl poly (dI·dC), 8 µl of nuclear extract isolated from control H9C2
cells and cells incubated with 2.5 µM DOX for 4h, and 4 pmol unlabelled CYP1A1 promoter
fragment. As a binding control, nuclear lysate from H9C2 cells treated with 25 nM of TCDD was
used. The binding mix was incubated for 20 min at room temperature and applied on pre-cast
6
CVR-2010-1018R2
6% DNA retardation gel. Samples were electrophoresed in 0.5x TBE buffer at 100V for 80 min.
Biodyne B Nylon Membrane was used to transfer DNA fragments (0.5xTBE buffer, 380mA for
50 min). Transferred samples were cross-linked to the membrane at 120 mJ/cm2 using
Stratalinker UV Crosslinker 1800. Detection was performed using Chemiluminescent Nucleic
Acid Detection Module kit according to the manufacturer’s protocol.
DNA laddering.
To perform DNA laddering analysis, a DNA ladder assay kit based on ligation-dependent
PCR was used. Briefly, 500 ng extracted genomic DNA was annealed with adaptors by heating
the mix at 50°C for 10 min and slowly cooling down to 10°C for 1 hour, and subsequently ligated
at 16°C overnight. Adaptor-ligated DNA (100 ng) was used for PCR with following reaction
profile: hot start at 72°C for 2 min, 94°C for 1 min, 35 cycles of 94°C 1min, 70°C 1 min, 72°C 1
min, final extension at 72°C for 10 min. PCR samples were run on 2% agarose gel and DNA
ladders were quantified by comparing intensities of lower bands with ImageJ software.
Oxidative status detection by lucigenin-enhanced chemiluminescence
Protein (200 μg) was diluted in PBS to a volume of 200 μL. To avoid significant redox
cycling and increase sensitivity, we added 75-μM lucigenin to each sample and incubated them
in the dark for 15 min (protocol adjustment revealed optimal incubation time before
luminescence detection ranged from 15-20 min). Lucigenin-derived chemiluminescence (LDCL)
was detected on TD 20/20 Luminometer (Turner Design, Sunnyvale, CA) within 5 min.
Cell viability detection
Cell viability was determined using a cytotoxicity detection kit based on the
measurement of lactate dehydrogenase (LDH) activity released from the cytosol of damaged
cells into the supernatant. Cells (2x104 cells/well) were plated in 96-well plates and rested for at
least 2-3 hours. Then resting medium was replaced with a similar medium containing 1% FBS
and 10 μM CH-223191. DOX (2.5 μM) was then added to cells and 24 hours later cell medium
was collected to measure LDH release.
7
CVR-2010-1018R2
Image Processing and Statistical Analyses.
Immunoblot and DNA laddering data were analyzed using ImageJ software. Data are
expressed as the mean±SD. Statistical comparisons between two groups were done using an
unpaired Student’s test. For comparisons of more than two groups, analysis of variance was
performed. Post hoc comparisons were performed using Tukey’s multiple comparison analysis.
All statistical analyses were performed using Prism 4.0 (GraphPad Software).
8
CVR-2010-1018R2
SUPPL Fig. 1. Chemical structures for doxorubicin and known activators of the aryl hydrocarbon
receptor.
9
CVR-2010-1018R2
SUPPL Fig. 2. Dose-response studies for the translocation of AhR in response to TCDD and
doxorubicin (n=3 for all groups).
10
CVR-2010-1018R2
SUPPL Fig. 3. Inhibition of doxorubicin-induced increases in CYP1A1 and GSTA1 RNA
expression by AhR siRNA transfection of H9C2 cells (n=3 for all groups). *p<0.01 vs. Scrambled
siRNA, †p<0.01 vs. Control for same group.
11
CVR-2010-1018R2
SUPPL Fig. 4. Representative ethidium bromide-stained agarose gels of PCR products showing
absence of CYP1A1 expression in hearts from AhR-/- mice (A). Doxorubicin treatment (10
mg/kg) of AhR-/- mice does not alter cardiac GSTA1 expression (B, n=5 for both groups).
12
CVR-2010-1018R2
SUPPL Fig. 5. Caspase 3 cleavage in AhR-/- hearts in vivo by treatment with 10 mg/kg of
doxorubicin (DOX).
13
CVR-2010-1018R2
SUPPL Table 1. Primers used for PCR and qPCR experiments
Gene
CYP1A1
Species
Mouse
CYP1A1
Rat
GSTA1
Mouse
GSTA1
Rat
CYP1A1
promoter
18S RNA
Rat
Rat and mouse
Sequence (5’-3’)
CTCTTCCCTGGATGCCTTCAA
GGATGTGGCCCTTCTCAAATG
CCTGGAGACCTTCCGACATTC
GGGATATAGAAGCCATTCAGACTTG
CCCCTTTCCCTCTGCTGAAG
TGAGCTTCACTGAATCTTGAAAG
CCACCTGCTGGAACTTCTCCTCTAT
AGGCTGCTGATTCTGCTCTTGAAGG
GGAGAGCTGGCCCTTTAAGA
CACCCAGCTACCCAACTCAC
CGCGGTTCTATTTTGTTGGTTT
GCGCCGGTCCAAGAATTT
14
Reference
2
3
4
5
–
CVR-2010-1018R2
SUPPL Table 2. Baseline echocardiographic features of wild type and AhR-/- mice (n=10 for
both groups).
Wild type
AhR-/-
Left ventricular inner dimension, diastole (mm)
4.08±0.42
4.02±0.46
Left ventricular inner dimension, systole (mm)
3.09±0.54
2.78±0.56
Posterior wall thickness, diastole (mm)
0.76±0.15
0.76±0.11
Posterior wall thickness, systole (mm)
1.03±0.15
1.13±0.25
Estimated left ventricular mass (mg)
108.2±11.6
110.3±18.1
15
CVR-2010-1018R2
REFERENCES
1.
Fujii-Kuriyama Y, Imataka H, Sogawa K, Yasumoto K, Kikuchi Y. Regulation of CYP1A1
expression. Faseb J 1992;6:706-710.
2.
Patel RD, Hollingshead BD, Omiecinski CJ, Perdew GH. Aryl-hydrocarbon receptor
activation regulates constitutive androstane receptor levels in murine and human liver.
Hepatology (Baltimore, Md 2007;46:209-218.
3.
Su T, Waxman DJ. Impact of dimethyl sulfoxide on expression of nuclear receptors and
drug-inducible cytochromes P450 in primary rat hepatocytes. Arch Biochem Biophys
2004;424:226-234.
4.
Ishikawa A, Jinno S, Suzuki T, Hayashi T, Kawai T, Mizuno T, et al. Global gene
expression analyses of mouse fibroblast L929 cells exposed to IC50 MMA by DNA microarray
and confirmation of four detoxification genes' expression by real-time PCR. Dent Mater J
2006;25:205-213.
5.
Li G, Xie P, Li H, Hao L, Xiong Q, Qiu T, et al. Acute effects of microcystins on the
transcription of 14 glutathione S-transferase isoforms in Wistar rat. Environ Toxicol 2009.
16