Supplementary information
Supplementary information includes Supplementary methods, Supplementary figure
legends, 2 Supplementary Tables and 5 Supplementary figures.
Supplementary methods
miRNA microarray analysis
miRNA microarray analysis was performed in MDA-MB-231 cells in the presence or
absence of TGF-1. Briefly, total RNA was harvested using the Trizol reagent
(Invitrogen) and the RNeasy Mini Kit (Qiagen) according to the manufacturer’s
instructions. The samples were labeled using the miRCURYTM Hy3TM/Hy5TM
Power Labeling Kit (Exiqon) and hybridized to the miRCURY LNA Array (Exiqon,
version 11.0). Scanning was performed with an Axon GenePix 4000B microarray
scanner. The GenePix Pro version 6.0 software program was used to read the raw
intensity of the image. Unsupervised hierarchical clustering was performed on the
miRNA expression profile.
Western blotting
Protein extracts were resolved with 8%～15% SDS-PAGE, transferred to PVDF
membranes and probed with antibodies against RB (1:1000,#9309,CST), c-jun（1:1000,
#9165,CST）, p-c-jun（1:1000, #2361, CST）,  laminB (1:100, 39095, Activemotif)
and -actin (Sigma). Peroxidase- conjugated secondary antibodies were used, and the
antigen-antibody reaction was visualized with the enhanced chemiluminescence assay
(ECL, Thermo).
1
Northern blotting
An aliquot (10 µg) of total RNA was subjected to denaturing (7 mol/liter urea)
polyacrylamide (15% acrylamide) gel electrophoresis, transferred to a Zetaprobe GT
membrane (Bio-Rad), immobilized on the membrane by ultraviolet cross-linking and
hybridized overnight at 42°C to a biotin-labeled deoxyoligonucleotide antisense to
miR-106b. The blots were reprobed with an antisense oligo specific to the U6 snRNA
as an RNA loading control. Chemiluminescent imaging was performed using the
Chemiluminescent Nucleic Acid Detection Module Kit (Pierce) according to the
manufacturer’s instructions.
qRT-PCR
qRT-PCR was performed in a LightCycler 480 instrument (Roche Diagnostics,) using
SYBR Premix Ex Taq TM (TaKaRa) according to the manufacturer’s instructions,
exept for mature miR-106b and U6 were detected by microRNA LNATM PCR
assays(Exiqon, Danmark, Cat 204760, 203907), according to manufacturer's
instructions. All the other qRT-PCR reactions were performed in a 25-l reaction
volume in triplicate. The primers for pri-miR-106b (sense: tccttaccgtgctctcattg,
antisense: tgcactgtcagcactttagcc), MCM7 (sense: aacaggtggctctgtatgtgg, antisense:
tgtacggcatcagcaaagag),
ggacttcgagcaagagatgg)
β-actin
(sense:
were obtained from
ggacttcgagcaagagatgg,
antisense:
Invitrogen. Following an initial
denaturation at 95oC for 30 s, 40 cycles of PCR amplification were performed at 95 oC
for 5 s and 60oC for 20 s. Standard curves were generated, and the relative amount of
target gene was normalized to U6, or β-actin. The specificity was verified by
performing a melting curve analysis and agarose gel electrophoresis. To quantify
2
cancer metastasis in mouse lung, RNA was extracted from fresh tissue using the TRIzol
reagent (Invitrogen, Carlsbad, California). qRT-PCR for human hypoxanthineguanine-phosphoribosyltransferase (hHPRT) was then performed using previously
described primers for hHPRT and 18S rRNA. Following reverse transcription for 45
mins at 42oC and Taq activation for 3 mins at 95oC, 40 cycles of PCR were performed
at 95oC for 12 s and 60oC for 15 s. serum miRNAs were isolated with the miRNeasy
Serum/Plasma Kit (QIAGEN).
RACE, EMSA and ChIP assay
RACE was conducted using SMARTer RACE cDNA Amplification Kit (634923,
Clontech, Mountain View, CA) according to manufacturer’s instructions.
A 28-bp putative cis-element encompassing the AP-1-like binding sequence (forward:
cgattctcctgcctcagcctcctgagta, reverse: tactcaggaggctgaggcaggagaatcg) was used for the
gel shift assay. Nuclear extracts were prepared using a NE-PER (R) Nuclear and
Cytoplasmic Extraction kit (Lot #78833, Pierce). The EMSA assay was performed
using the LightShift Chemiluminescent EMSA kit (Pierce). For competition
experiments, the indicated molar excess of specific competitor DNA was added at the
beginning of the pre-incubation phase prior to the addition of labeled oligonucleotides.
The
ChIP
assay
was
performed
using
the
EZ-Magna
ChIP
Chromatin
Immunoprecipitation kit (17-408, Millipore) according to the manufacturer’s
instructions. The following primers were used to detect immunoprecipitated DNA:
forward: CAGACATGTCCAGAGCCTCA, reverse: CTTGAATCTGGGAGGCAGAG.
Preparation of single-cell suspensions of breast tissue.
3
Primary tumor samples were obtained by surgery, then were immediately mechanically
disaggregated and digested with collagenase. Single-cell suspensions were obtained by
filtration through a 40-m filter. Cell sorting was performed on single-cell suspensions
using an Epics Altra flow cytometer (Beckman Coulter) as we previously described(1)
All of the samples were collected with informed consent according to the internal
review and ethics boards of SunYat-Sen Memorial Hospital.
Supplementary figure legends
Supplementary figure 1. TGF-1 up-regulates miR-106b.
(a-b)The dynamic expression of primary miR-106b in MDA-MB-231 (black line),
MCF-7 (blue line) and MCF-10A (red line) cells (a) and primary breast cells from
H-cancer (black line), L-cancer (blue line) and normal breast tissue (red line). (b)
during the time course of 5 ng/ml TGF-1 treatment. The bars correspond to the
mean±SD. ***, p<0.001 and *, p<0.05 compared to untreated cells. H-cancer,
high-invasive breast cancer. L-cancer, low-invasive breast cancer.
Supplementary figure 2. MiR-106b determines TGF-’s effect on cell growth.
(a) MiR-106b expression determined by qRT-PCR in MDA-MB-231, MCF-7 and
MCF-10A cells transfected with the negative control (NC), miR-106b mimics (106b), or
treated with TGF-1 and TGF-1 combined with 106b ASO. ***, p<0.001 and *,
p<0.05 compared to NC. (b) Quantification of total cell DNA with Hochest33258 in
MDA-MB-231, MCF-10A and MCF-7 cells teated as in a. (c) Representative flow
cytometric histograms of BrdU staining in MDA-MB-231 cells treated as in a. (d) The
3’ UTRs of the RB mRNAs that contain binding sites for miR-106b (WT) or mutated
4
binding sites (MUT) for miR-106b. (e) The luciferase assay was performed in
MDA-MB-231 cells that were co-transfected with miR-106b mimics and reporter
vectors carrying RB 3’-UTR with a wild-type or mutated miR-106b response element.
(f) The protein level of total RB in L-cancer cells (left of dotted line) and H-cancer cells
(right of dotted line) that were mock transfected, transfected with lin4 (lin4) or
miR-106b (106b) mimics, or treated with TGF-1 or TGF-1 combined with lin4 ASO
or 106b ASO. H-cancer, high-invasive breast cancer. L-cancer, low-invasive breast
cancer.
Supplementary figure 3. The interaction between c-jun and miR-106b-promoter region
was confirmed upon TGF- treatment.
(a) Sequence analysis revealed an AP-1 binding motif (TGCCTCA with an A→C
substitution) located in the region 523-715 bp upstream of the TSS of the miR-106b-25
cluster. (b) Binding of c-jun to the AP-1 binding site (TGCCTCA) in the presence of
TGF-1 confirmed by EMSA assays. (c) Phosphorylation (Ser63) and total c-jun in the
nuclei of different primary breast cells following TGF-1 treatment for 6 h. (d)
miR-106b promoter activity of different primary breast cells measured by the luciferase
reporter assay after treatment with TGF-1. The bars correspond to the mean±SD. *,
p<0.05, **, p<0.01 and ***, p<0.001 compared to the PBS-treated cells. H-cancer,
high-invasive breast cancer. L-cancer, low-invasive breast cancer. (e) MCM7 promoter
activity of different breast cells lines measured by the luciferase reporter assay after
treatment with TGF-1. The bars correspond to the mean±SD. **, p<0.01 compared to
the PBS-treated cells.
5
Supplementary figure 4. MiR-106b determines TGF-1’s effects on tumor growth and
metastasis.
(a) Wet lung weight in tumor-bearing mice. (b) The number of metastatic liver nodules
in tumor-bearing mice. The bars correspond to the mean±SD. **, p<0.01 and ***,
p<0.001 compared to PBS-treated cells.
Supplementary figure 5. MiR-106b plays a central role in determination of TGF-’s
effect on tumor progression.
Schematic representation shows molecular mechanisms by which miR-106b determines
whether TGF- suppresses or promotes cancer progression in normal/low–invasive
cancer cells or high-invasive breast cancer cells.
1.
Yu, F., Yao, H., Zhu, P., Zhang, X., Pan, Q., Gong, C., Huang, Y., Hu, X., Su, F., Lieberman, J.,
et al. 2007. let-7 regulates self renewal and tumorigenicity of breast cancer cells. Cell
131:1109-1123.
6