Microsatellite loci and PCR conditions
The microsatellite analysed were GATA028, GATA098 and GATA417 (Palsboll et al. 1997),
GT023 (Bérubé et al. 2000), Dde70 (Coughlan et al. 2006), Bmy57 and Bmy11 (Huebinger et
al. 2008), Tur4_91 (Nater et al. 2009), and BM032 (F: 5’CTCCATATTGTGCCGTGGAT, R:
5’AGAAGCCAGACCCATAGCTG, GenBank Accession no. HQ130732) and BM261 (F:
3’TGTCGATACAAAGCCCACTG, R: 5’CAAGGTCATGGAAATCATGC, GenBank
Accession no. HQ130733) developed for blue whales using methodology described in
Beheregaray et al. (2004).
When using the method based on Schuelke (2000), amplifications were performed in a
10 µl reaction containing ~50-100 ng template DNA, 2 pmol fluorescent-labelled M13(-21)
primer, 0.4 pmol forward primer and 2 pmol reverse primer, 200 M each dNTP, 2 mM
MgCl2 (GATA028, GATA417, GT023, BM032, BM261) or 2.5 mM MgCl2 (GATA098,
Dde70, Bmy57, Bmy11, Tur4_91), 0.5 g/L BSA, 0.5 U GoTaq Flexi DNA polymerase and
its reaction buffer (Promega). The temperature profile was 94oC 3 min, then cycles of 94oC 20
s, 63oC 45 s reducing by 2oC every cycle until stabilising at 53oC, and 72oC 1 min, then a final
extension of 72oC 10 min. The total number of cycles was 30 (Bmy57, Bmy11), 33 (Dde70),
35 (GATA417, GT023, BM032, BM261), 36 (GATA028) or 39 (GATA098, Tur91). Since
genotyping occurred at two separate laboratories (each using a different amplification method:
Leduc et al. (2007) or the above method), size discrepancies of genotypes were calibrated by
genotyping and comparing five samples at both laboratories.
References
Beheregaray LB, Möller LM, Schwartz TS, Chao NL, Cannone A (2004) Microsatellite
markers for the cardinal tetra Paracheirodon axelrodi, a commercially important fish
from central Amazonia. Mol Ecol Notes 4:330-332
Bérubé M, Jørgensen H, Mcewing R, Palsbøll PJ (2000) Polymorphic di-nucleotide
microsatellite loci isolated from the humpback whale, Megaptera novaeangliae. Mol
Ecol 9:2181-2183
Coughlan J, Mirimin L, Dillane E, Rogan E, Cross TF (2006) Isolation and characterization of
novel microsatellite loci for the short-beaked common dolphin (Delphinus delphis)
and cross-amplification in other cetacean species. Mol Ecol Notes 6:490-492
Huebinger RM, Patton JC, George JC, Suydam R, Louis EE, Bickham JW (2008)
Characterization of 25 microsatellite loci in bowhead whales (Balaena mysticetus).
Mol Ecol Resour 8:612-615
Nater A, Kopps AM, Krützen M (2009) New polymorphic tetranucleotide microsatellites
improve scoring accuracy in the bottlenose dolphin Tursiops aduncus. Mol Ecol
Resour 9:531-534
Palsbøll PJ, Berube M, Larsen AH, Jørgensen H (1997) Primers for the amplification of triand tetramer microsatellite loci in baleen whales. Mol Ecol 6:893-895