G. Volckaert
Gene & genome technology
part 02
15/02/2016
p.1
02. Enzymatic armamentarium of recombinant DNA
Purposes of enzymatic reactions
a. fragmentation: mostly restriction enzymes, but also less specific activities
b. copying: with polymerases
c. other manipulations: changing the ends, joining the ends, etc
Can be grouped into different classes
1. polymerases : DNA polymerases, RNA polymerases, replicases, reverse transcriptases
2. 'modifying' enzymes : which introduce changes in nucleic acids other than the above
(e.g. (pyro)phosphatases, polynucleotide kinase, topoisomerases, helicases,
methylases, DNA binding proteins, etc.)
3. ligases
4. nucleases : DNases, RNases, exonucleases, endonucleases, …
largest group : restriction endonucleases
1. polymerases
- general properties
- stability
- processivity : “how far the polymerase travels along the template before leaving it…”
- substrate sensitivity (GC-content, (deoxy)ribosubstitution)
- some sequence regions may lead to polymerase pausing or halting
- some eukaryotic polymerase can copy beyond damaged positions (error-prone)
- accuracy
- intrinsic and/or as a consequence of proofreading/repair systems
- activities
- polymerisation
- pyrophosphorolysis
- 5' => 3' exonucleolytic
- 3' => 5' exonucleolytic
- strand displacement
- no DNA polymerase can make de novo starts ; requires a free 3’-OH end
G. Volckaert
Gene & genome technology
part 02
15/02/2016
p.2
- DNA polymerase I : the first ever discovered polymerase (of E. coli)
by Arthur Kornberg (hence also named Kornberg polymerase)
- has 5 =>3' and 3'=>5' exonuclease, and strand displacement activities
- not the main polymerase (which is DNA polymerase III) but involved in repair
- Klenow polymerase fragment A
- proteolytic fragment of Kornberg polymerase (the larger one of two fragments)
- 3'=>5' exonuclease and strand displacement activity (5' => 3' exo on fragment B)
- 3'=>5' exonuclease is proofreading activity : removes false incorporations
- T4 & T7 polymerase (sequenase) : bacteriophage-coded enzymes
T4 polymerase :
- polymerisation and 3'=>5' exonuclease activities
- 3'=>5' exo 200 x stronger than Klenow polymerase
- not proofreading, since also active onto dsDNA
=> directed by the presence/absence of dNTP
T7 polymerase :
- highly processive, particularly useful in DNA sequencing
- modified forms to inactivate 3’=>5’ exonuclease
=> named Sequenase I & Sequencase II
- Taq polymerase : the first thermoresistant polymerase used in PCR
- accuracy is weak (no 3'=>5' exo-proofreading)
- has 5’=>3’ exonuclease activity and adds an extra adenylate to the 3’ ends
(cfr. terminal transferase, but only a single monomer is added)
(any of the 4 nucleotides can be added, but A is preferred in a dNTP mixture)
- stable at >90°C, optimal reaction temperature around 72 °C
- other thermoresistant polymerases (Pfu, Vent, Tub, Tth, etc.)
- some displaying much higher thermal stability than Taq
- natural and/or engineering enzymes with respect of the exo-activities
- Tth can also use RNA as a template (in the presence of Mn2+)
- reverse transcriptase (& RNase H)
- avian myeloblastosis virus reverse transcriptase (associated RNaseH ?)
- (Moloney strain of) murine leukemia virus (RNaseH activity in C-terminal)
- poor processivity of the native enzymes ; and tend to stall at 37°C
- engineered mutants that lack RNase H activity : active at higher temperatures
(up to 50°C and even 60°C)
G. Volckaert
Gene & genome technology
part 02
15/02/2016
p.3
Techniques
- nick-translation
- tinkering at fragments: filling-in, removing extensions, etc.
- radioactive labelling and tagging
- PCR amplification (see later)
- cDNA synthesis
- RNA polymerases
- the cellular enzymes synthesizing mRNA are complex multisubunit complexes
- they recognize typical bacterial (consensus) promoter sequences
- phage-encoded RNA polymerases consist of single polypeptide chains with
typical unique promoter sequences
T7 RNA polymerase : TAATACGACTCACTATAGGGAGA
T3 RNA polymerase : AATTAACCCTCACTAAAGGGAGA
SP6 RNA polymerase : ATTTAGGKGACACTATAGAAG
(starting nucleotide in bold: +1 to -7 common region, -8 to -12 promoter-specific)
- the latter enzymes allow for in vitro transcription on DNA fragments
up to large amounts of RNA copies (up to mg amounts)
- those promoters are different from the cellular promoters and are not
recognized by the E. coli RNA polymerase (hence no interference)
2. 'modifying' enzymes
- alkaline phosphatases : dephosporylation (phosphomonoesterases)
- removal of phosphate from 5’-, 3’- and 2’-ends of nucleic acids and
other mono-esterified structures
- they are all Zn(II) metalloenzymes, catalyzing monoester hydrolysis
through the formation of a phosphorylated serine intermediate
- BAP, CIAP, SAP : stability versus lability
BAP : very stable, difficult to inactivate, E. coli enzyme
(remove by SDS-phenol extraction after treatment at >60°C)
CIAP : from calf intestine, easier to inactivate (but still requires extraction)
SAP : from a cold-blooded (arctic) shrimp : completely inactivated at 65°C
- inhibited by inorganic phosphate, chelators of metal ions (EDTA, EGTA)
- pyrophosphatase : e.g. Tobacco acid pyrophosphatase (TAP)
=> cleaves the phosphoanhydric bonds in dNTP, rNTP, CAP structures, …
G. Volckaert
Gene & genome technology
part 02
15/02/2016
p.4
- T4 polynucleotide kinase : 5'-phosphorylation
- transfers the -phosphate of ATP to the 5’ end (directly to a 5’-OH, or
by an exchange reaction)
- applications : - enabling ligation (of e.g. synthetic fragments)
- 5’-terminal labeling
- terminal deoxynucleotidyl transferase (TdT)
- polymerisation without copying
- monomeric enzyme catalyzing the addition of mononucleotides to a
3’-OH of DNA molecules (ss or ds)
- minimal starter (p)N-N-NOH ,
- substrates dNTP, rNTP, ddNTP, …
- Co2+ or Mn2+ are the preferred cofactor, depending on the kind of nucleotide
- when using a single (d)NTP, (3’-)homopolymeric tails are created
- with ddNTP, single additions are feasible (or rNTP followed by alkali)
- topoisomerases
- Topo I
L=1 (nicking-closing)
- Topo II L=2 (ds cleavage, gyrase, …)
3. ligases
- intra- and intermolecular coupling of strands
- DNA ligases (ds-specific), RNA ligase (ss-specific)
T4 DNA ligase, E. coli DNA ligase, T4 RNA ligase
- mode of action: cofactor (NAD, ATP)
- nick closure, sticky end ligation, blunt end ligation :
- efficiency
- re-cleavage
- effect of DNA concentration : circularisation versus concatenation
- avoiding circulation by dephosphorylation
- conversion blunt end to sticky end with linkers & connectors
- linkers
- multimerisation
- methylation of internal sites
- connectors ("adaptors")
- dimerisation
- unique additions
G. Volckaert
Gene & genome technology
part 02
15/02/2016
p.5
- T4 RNA ligase : donor of 5’-phosphate, acceptor with 3’OH
=> use of pCp as (radioactive) donor
- thermoresistant ligase : Pfu ligase : LCR (ligase chain reaction)
- survey of DNA-coupling strategies
- use of T4 DNA ligase
- homopolymeric tailing
- use of polymerase T4 (LIC)
- topoisomerase ('TOPO cloning')
- SOE ('splicing by overlap extension') : (see later in PCR-chapter)
4. nucleases
- exonucleases versus endonucleases ; DNases and RNases
- DNaseI (from bovine pancreas)
=> nicking (double-stranded DNA)
- nicking is virtually random : produces 5'-phosphate + 3'-OH
- requires Mg2+ for nicking
replacing Mg2+ by Mn2+ => second cleavage opposite the nick = ds cleavage
- cccDNA can be singly nicked (to ocDNA) in the presence of ethidium+
- Nuclease S1 & Mung bean nuclease
=> endonucleolytically cleaving single-strands
- attack both DNA and RNA if single-stranded
- optimal activity around pH 4 to 5 : leave 5'-phosphate + 3'-OH
- Zn2+ required
- "breathing" of the ends can lead to trimming of some "ds" positions
more difficult to control with nuclease S1 than with mung bean nuclease
- allows to excise loop structures (hence, cleavage is endonucleolytically)
- “randomness”
- ribonucleases : (isolated since the 50's and 60's ; several were crystallized)
- endoribonucleases unless otherwise indicated
- base-specific cleavages by RNase T1 (following Gp), RNase A (following Yp),
RNase U2 (following Rp), RNase T2 (following Np)
=> hence all T1-oligonucleotides terminate by Gp, etc.
- large preference for single-stranded molecules and regions
- RNase H
- degrades RNA strand in DNA:RNA heteroduplexes
G. Volckaert
Gene & genome technology
part 02
15/02/2016
p.6
- widely distributed in nature
- enzymes from bacteria and eukaryotic cells are endoribonucleases
- viral enzymes are (also?) exonucleases that remove progressively
5'-mononucleotides from both the 5' and 3' end
- links of ribo- to deoxyribonucleotides are not cleaved by the bacterial RNase H
but are cleaved by the viral and eukaryotic enzymes
- exonucleases : numerous enzymes were isolated with their own particular activities
- exonuclease III (of E. coli)
- substrate ds DNA ; not active on 3' extensions > 3 and not ending by C
- removes stepwise pN starting at the 3' end (OH or P, as a phosphatase)
- end-product : two half-strands
- optimal activity with Mg2+ or Mn2+
- not processive or processive depending on the reaction conditions
- very efficiently controlled by time & temperature => progressive deletions
=> method of Henikoff
- (nb. other activities in DNA repair)
- exonuclease VII
- active on ssDNA from both 3' and 5' ends
- shortens extensions in dsDNA to blunt ends but is inactive on loops
- does not require divalent metal ions => not sensitive to EDTA !
- processive ; releases oligonucleotides of n=2-12 (no mononucleotides !)
- phosphate may be present at either 5' or 3' end
- main applications : removal of ss-regions ; eliminating excess primers after PCR
- phage  exonuclease
- most active on dsDNA (no absolute specificity) (ds 100x
- removes pN from the 5' end (only 5'-P, not on 5'-OH)
- requires Mg2+
- not active on a nick or a gap
> than ss)
- T7 gene 6 exonuclease
- active on dsDNA, 5'-phosphate as well as 5'-OH
- low or no processivity : more uniform pattern than by  exonuclease
- M2+ absolutely required : 5 mM Mg2+ or 1 mM Mn2+ ; also sulfhydryl agent (DTT)
- snake venom phosphodiesterase : releases pN
- exonucleolytic from 3'-OH on DNA and RNA, both ss and ds
G. Volckaert
Gene & genome technology
part 02
15/02/2016
p.7
- calf spleen phosphodiesterase : releases Np
- exonucleolytic from 5'-OH on DNA and RNA, in particular ss
restriction endonucleases
Werner Arber, Hamilton Smith, Daniel Nathans : nobelprijs 1978
Arber & Dussoix, 1962
: genetic analysis ; suggested endonuclease + modification
Meselsohn & Yuan, 1968 : isolated E. coli K endonuclease (EcoK)
Arber & Linn, 1968
: isolated E. coli B endonuclease (EcoB)
Smith & Wilcox, 1970
Danna & Nathans, 1971
: isolated H. influenzae endonuclease HindII (+ HindIII)
: cleavage and fractionation of SV40 restriction fragments
- restriction-modification phenotype : analysis of efficiency of phage infection
- type II endonucleases
- nomenclature : genus (1) + species (2) names + strain indication + roman number
e.g. AluI, HindII, HindIII, EcoRI
R. M. I. PI. Nt. Nb.
- sticky ends versus blunt ends
- 5' extension, 3' extension
- position of phosphate moiety
- recognition site diversity:
- 4-mer, 6-mer, 8-mer palindromes
- interrupted palindromes
- non-palindromic (Class-IIS)
- isoschizomers, neoschizomers
- cfr. cross-reference table
- cleavage frequency
- non-randomness
- G+C content
- CTAG deficiency in E. coli (& bacteria), CG deficiency in eukaryotes
- kinetic differences
- star activity
- converting sites into others by filling-in and ligation
- 'families'
G. Volckaert
Gene & genome technology
part 02
15/02/2016
p.8
e.g. GATC 5’ extensions (MboI, Sau3AI, BamHI, BglII, BclI, XhoII)
compare to DpnI, PvuI, …
- methylation, dam, dcm, etc
- full or side-effect on restriction activity
- hemi-methylation
- gel electrophoresis
- agarose gel, polyacrylamide gel
sieving effect
- staining versus autoradiography
staining with ethidiumbromide or SYBR under UV light
radioactive labeling for autoradiography (on X-ray film)
silver staining (< 0.1 ng DNA)
- quality control (via ligation and recleavage)
- size estimation: D = a – b(logM)
(M= Mr, length, number of base pairs)
- use of size markers and ladders
- calibration curve
- pulsed-field gel electrophoresis : fragments of 20 kb and much larger
- mapping : 10 kb : fragments 4.3 + 2.7 + 1.7 + 0.6 + 0.6 + 0.1 : what is the order?
- double digestion, partial digestions
- RFLP : restriction fragment length polymorphism
other enzymes / proteins:
methylases : see Restriction enzymes
poly(A) polymerase : addition of A-tail to RNA fragment
polynucleotide phosphorylase : polymerisation of NDP to RNA
RecA protein : binding of single-strands to homologous regions in dsDNA
T4 gene 32 protein : ssDNA binding protein