Brice Kessler
Bio 303, Ely
The Genetics of Thoracic Aortic Aneurysms
An aortic aneurysm is a swelling of the aorta resulting from weakness in the aortic wall. This
weakness can be the result of protein defects, trauma, infection, or destruction of wall proteins by
enzymes. Thoracic aortic aneurysms (TAA), the second most common form of aortic aneurysm
behind abdominal aortic aneurysms, are aneurysms that occur specifically in the thoracic aorta.
The biggest concern with TAA is a rupture from the swelling that would result in massive
internal hemorrhaging and death if not treated immediately by surgery. Little is known about the
genetics behind TAA in patients that don’t have Marfan syndrome, a genetic disorder
predisposing a person to cardiovascular issues. Because nonsydromatic TAA is largely
asymptomatic and even with frequent screenings it can be impossible to tell if an individual may
later develop swelling, an understanding of the genetics behind TAA and aortic aneurysms in
general would be invaluable.
One study attempted to characterize a non-invasive peripheral blood-based gene profile to
identify at-risk individuals (Wang et al. 2007). The researchers looked at circulating leukocytes
since they would come into close contact with the diseased thoracic aortic tissue. They
hypothesized that gene expression patterns in the blood cells would reflect possible TAA disease
status. Similar studies have been performed using peripheral blood cells to create gene
expression profiles for systematic lupus erythematosus, rheumatoid arthritis, and multiple
sclerosis. An accurate blood-based test for TAA risk would far surpass the effectiveness of
current screening techniques for TAA.
To create the profile the researchers collected blood from 58 asymptomatic TAA patients.
They used spousal controls as a spouse would share similar diets, ages, and ethnicities. DNA
microarrays were then used to analyze gene expression profiles of samples from the patients and
the controls. A DNA microarray is a collection of microscopic DNA spots which represent genes
arrayed on a solid surface. After obtaining profiles for the patients and controls, a program called
SAM (significance analysis of microarrays) was used to determine which genes in the TAA
patients significantly differed from the spousal controls. The results showed that 988 genes were
over-expressed in TAA patients and 211 genes were under expressed. After further comparison
of the results to accepted gene sets to further isolate variables the researchers came up with a 41classifier gene set. The classifier set was found to correctly identify TAA at-risk individuals
with 78-80% accuracy all with a simple blood test.
However, these results could be misleading. The information being dealt with in this
experiment is highly multidimensional. It would be nearly impossible to isolate only the direct
genetic effect of TAA on peripheral blood cells. Also, because of the extensive statistical
analysis required to interpret the results, the researcher’s findings are more a reflection of how
the researchers chose to look at the data instead of what the data might actually say. This
experiment does, however, give some insight to possible genetic basis for TAA.
Similar research methods are thus more useful to determine possible pathways for further
research in exploring the genetics of aortic aneurysms. One such study focused on the increased
expression of matrix metalloproteinases in TAA patients (Taketani et al. 2005). Matrix
metalloproteinases (MMPs) are required for the breakdown of matrix proteins and have been
shown to be increased in TAA patients. The researchers in this study took TAA tissue samples
from 20 TAA patients and also obtained unaffected tissue from each patient that was 5
centimeters away from the TAA tissue for comparison. DNA microarrays were then created for
each of the 20 TAA samples and the 20 near TAA samples. A statistical analysis similar to SAM
was then used and identified 220 genes that were significantly up-regulated in the TAA patients.
In addition to MMP over expression the study shed light on new possible genes of interest for
further research. ADAMTS1 was one gene found to be significantly over expressed. ADAMTS1
is involved in the degradation of enzymes found in the aortic wall and is also involved in the
proteolysis of proteins expressed in atherosclerotic aortas. Several genes involved in apoptosis
were also up-regulated and it is known that apoptosis of vascular smooth muscle cells is increase
in aneurismal aortic tissue. Many of the genes identified were also involved in immune reactions
showing that proinflammatory responses in the cells of TAA samples were more activated than
in the normal tissue. The most significantly increased gene expressed in TAA tissues was found
to be Pleckstrin which is involved in cellular proliferation and differentiation, increased MMP
transcription, and whose activity has been seen in atherosclerosis.
The study implicated numerous proteinases, inflammation-related genes, signaling-pathway
genes, and apoptosis-related genes. However, this study shares the same weaknesses as the
previously discussed study (Wang et al. 2007). The “results” are more reflective of the specific
statistics used to obtain them. Unlike the previous study, this study used direct tissue samples to
find candidate genes for further research instead of indirectly characterizing TAA to obtain a
non-invasive clinical test. The results in the direct tissue microarray analysis shed light on
possible pathways that can be taken to fully understand TAA.
To further understand the genetics underlining TAA, Wung et al. (2004) attempted to map
the chromosomal regions predisposing people to thoracic aortic aneurysms. To do this, they
looked at nonsydromatic TAA patients with a family history of TAA. The first chromosomal
region was mapped using fifteen different families that all had extensive histories with TAA.
This locus was mapped on the long arm of chromosome 5 (5q13-14) and was termed TAAD1.
The researchers observed that family members who did not have TAA issues shared similar
markers in this region for TAA with those that had TAA. This concordance could mean that the
penetrance for the disease is fairly low. A second chromosomal locus was mapped on the long
arm of chromosome 11 (11q23-24) and was termed FAA1. However, the disease in the families
used to identify this locus was characterized by aneurysms affecting multiple segments of the
aorta. The researchers hypothesized that the second locus was responsible for a different version
of the disease than what is seen with most TAA patients. A third locus was mapped on
chromosome 3 (3p24-25) and was called TAAD2. This region has received particular interest
because it shares many similarities to the region in a Marfan syndrome patient.
Three Possible Chromosomal Regions with Gene Resulting in TAA
Diagram showing the three chromosomal regions hypothesized to contains genes
predisposing an individual to TAA. Region TAAD2 is marked off by gene markers
D3S3701 and D3S1211. (Wung et al. 2004)
Genes that code for products that participate in the degradation of connective tissue and
remodeling of the vasculature of the heart, like MMPs, would be obvious candidates for the
genes in question. Not surprisingly several MMP genes are located in the TAAD2 locus and are
expressed at elevated levels in TAA patients. Decreased levels of tissue inhibitors of MMPs
(TIMPs) have also been targeted as a cause for TAA.
Chen et al. (2006) looked specifically at the metalloproteinase gene 9 (MMP 9) which was
found in the TAAD2 region. The MMP-9 protein plays a major role in the maintenance of the
aortic wall and is critical to arterial wall remodeling. When MMP-9 is overproduced, a weakened
aortic wall can result. To look at the genetic code of the MMP 9 gene, the researchers collected
blood and tissue samples from 88 patients with TAA and 111 control patients. The genomic
DNA from these samples was isolated and genotyping was accomplished with the ICycler iQ
Real-Time Detection System. Three single nucleotide polymorphisms were found:
Single nucleotide polymorphism genotyping assay information
SNP
Context sequence
−8202A/G
5′GCCCAGCCCAGCCTGCAGCCCTGGG[A/G]CTCTGCAGCAGCACAGTCAGAAATG
3′
IVS4+3G/T
5′GTGGTCCCTGGGCAAGGGCGTCGGT[G/T]AGATTCTGAGTCCTCCTGGCCCCTG
3′
2003A/G
(Q668R)
5′GACACGCACGACGTCTTCCAGTACC[A/G]AGGTGAGGGCTGAGGAGGATCCCTT
3′
Table showing the three single nucleotide polymorphisms found by researchers in the
MMP 9 gene, -8202A/G, IVS4+3G/T, and 2003A/G(Q668R) (Chen et al. 2006).
The frequency of the −8202G SNP was significantly higher in patients with TAA than in the
control subjects. The proportion of −8202G carriers was also significantly higher in the patients
with TAA than in the control subjects. The researchers found that patients with TAA were 14
times more likely to have the G allele than were control subjects. 82% of the patients with the 8202A/G SNP either had TAA or had a family history with TAA. Patients with TAA were 4
times more likely to have the G allele than were control subjects. The other two single nucleotide
polymorphisms found did not statistically differ from the norm. The researchers hypothesized
that the −8202A/G SNP, which occurs in the 5′ untranscribed region of the MMP9 gene, might
have an enhancer element that increases MMP9 transcription, resulting in high MMP 9 levels
that would increase susceptibility to TAA. However, this study was only an association study.
Further research involving functional investigations of the MMP 9 gene are required to
definitively target the gene as responsible for nonsyndromatic TAA.
The nonsymptomatic and potentially deadly nature of thoracic aortic aneurysms warrants
further investigation into the genetics underlining the disease. Through characterization of the
disease by gene expression profiles and further research into candidate genes found it is possible
to isolate and identify genetic factors that predispose a person to TAA. Though the genetics of
nonsydromatic TAA are still not entirely understood, current research has identified promising
pathways in characterizing the issue that may one day lead to a gene based diagnostic and
treatment for the disease.
References:
Chen, Li, Xinwen Wang, Stacey A. Carter, Ying H. Shen, Heather R Bartsch, Robert W.
Thompson, Joseph S. Coselli, David L. Wilcken, Xing Li Wang, and Scott A LeMaire.
"A Single Nucleotide Polymorphism in the Matrix Metalloproteinase 9 gene is associated
with Thoracic Aortic Aneurysms and Thoracic Aortic Dissection." The Journal of
Thoracic and Cardiovascular Surgery. 131(2006): 1045-52.
Taketani, Tsuyoshi, Yasushi Imai, Tetsuro Morota, Koji Maemura, Hiroyuki Morita, Dobun
Hayashi, Tsutomu Yamazaki, Ryozo Nagai, and Shinichi Takamoto. "Altered Patterns of
Gene Expression Specific to Thoracic Aortic Aneurysms: Microarray Analysis of
Surgically Resected Specimens." International Heart Journal. 46(2005): 265-77.
Wang, Yulei, Catalin C. Barbacioru, Dov Shiffman, Sriram Balasubramanian, Olga Iakoubova,
Maryann Tranquilli, Gonzalo Albornoz, Julie Blake, Necip N. Mehmet, Dewi Ngadimo,
Karen Poulter, Frances Chan, Raymond R. Samaha, and John A. Elefteriades. "Gene
Expression Signature in Peripheral Blood Detects Thoracic Aortic Aneurysm." PLoS
ONE. 17(2007): e1050
Wung, Shu-Fen, and Bradley E. Aouizerat. "Newly Mapped Gene for Thoracic Aortic Aneurysm
and Dissection." Journal of Cardiovascular Nursing 19(2004): 409-16.