Supplementary Table and Figure legends
Supplementary Figure 1: Cell lysis of HepG2 cells caused by armed MeV. HepG2 cells were
treated with the suicide gene therapy and LDH release was determined at 4 dpi. Squares:
mock; Triangles: MOI 0.001; Circles: MOI 0.01; Asterisks: MOI 0.1. Values: mean of three
independent experiments performed in quadruplicates. Error bars: SEM.
Supplementary Figure 2: Virus replication in tumors. Vero cells were infected as described
in figure 6A. Pictures show cells three days after infection with two mice per treatment
group. (A): mock-infected Vero cells. (B) to (G): Vero cells infected as described; the
treatment groups from which the tumors were derived are specified in the panels. Syncytia
are framed in red. The days after treatment initiation at which the respective mice were
sacrificed are specified (e.g. d 32). The scale bar in A (200 µm) applies to all panels.
Supplementary Figure 3: Histological analysis of tumor tissue. Tumor samples treated as
described in figure 6B. Treatment groups and days after treatment initiation at which the
respective mice were sacrificed (e.g. d 32) are specified in the figure. The scale bar in the top
left panel (200 µm) applies to all panels.
Supplementary Table 1: Tumor-free animals. Animals with a complete remission are shown.
Causes of death: a: sacrificed due to renal failure. b: end of experiment. c: death by unknown
reason.
1
Supplementary Methods
Construction of recombinant MeV
The MeV-Schwarz cDNA was constructed from RT-PCR fragments derived from an original
vaccine batch (Mérieux, Sanofi-Pasteur, Leimen, Germany). Details on the primers, the
cloning and the rescue strategy can be obtained from the authors upon request. In brief, the
viral vectors were constructed as follows: the viral cDNA was inserted into a plasmid
containing regulatory sequences (promoter, terminator) derived from cytomegalovirus
(CMV). In this cDNA, an empty additional transcription unit (ATU) was integrated into
genome position one. This ATU was synthesized by fusion PCR using primer pairs (i)
GAGCGGATAACAATTTCACACAGG
TATAACAATGATGGATGGCGCGCCTCGAGATATCCCTAATCCTGCTCTT
CGCGCCATCCATCATTGTTATAAAAAACTTAGGATTCAAGATCCTATT
and
and
(ii)
and
CCTATTAGTGCCCCTGTTAGTTT. The open reading frames encoding SCD or VP22SCD were
inserted via restriction sites compatible to the unique AscI cloning site (underlined) within
the ATU and the viruses were rescued by transfection of Vero cells with 5 µg viral cDNA, and
a mixture of plasmids encoding the viral proteins N, P, and L under the control of the CMVpromoter (500, 100, and 500 ng, respectively) in FuGene HD (Roche, Mannheim, Germany).
To prepare virus stocks, Vero cells were infected at MOI 0.03 and incubated at 37 °C for
about 54 h until the majority of cells had formed syncytia. The cells were scraped in OptiMEM, and virus was released by one freeze/thaw cycle. Titers were determined by 50%
tissue culture infectious dose (TCID50) titration on Vero cells34.
2
Lactate dehydrogenase (LDH) assay
5*104 cells/well were cultured in 24 well plates and treated with the suicide gene therapy.
LDH activity was determined in the supernatants as well as in cell lysates (in 0.1% triton X100 (Carl Roth, Karlsruhe, Germany) in PBS) with the LDH-P mono kit (Biocon,
Voehl/Marienhagen, Germany) according to the manufacturer’s recommendations. Values
represent the ratio of LDH activity in the supernatant and the total LDH activity in each well.
3