DNA Electrophoresis Review:
Name_______________________________
1. Write a short paragraph that answers the following questions:
a) What is CODIS?
CODIS (Combined DNA Index System) is a computer software program developed by the
FBI that maintains local, state, and national databases of DNA profiles from convicted
offenders, unsolved crime scene evidence, and profiles of missing persons.
b) What type of DNA is of interest in forensic science?
Typically forensic scientists are interested in STRs as opposed to full DNA strands
c) What is a STR (as used by CODIS)?
Short Tandem repeats are locations on the chromosome that contain short sequences that
repeat themselves within the DNA molecule
Currently, U.S. crime laboratories have standardized on 13 STRs for entry into a national
database (CODIS).
2. True/false
Indicate whether the following statements about DNA electrophoresis are true or false. Write true
or false in each blank.
__T___ The separation of DNA fragments is based on their size.
___F__ DNA standards are not used in most electrophoretic runs.
___T__ Each band on the gel contains millions of DNA fragments.
__T___ DNA fragments move down the gel because their net charge is negative.
__F___ The DNA fragments of highest molecular weight will be found at the
bottom of the gel.
3. Examine the DNA profile in the real DNA fingerprint (activity 2).
http://www.ncsu.edu/project/bio183de/Lab/dna_fingerprinting/criminals.html
Do you think that the defendant is innocent or guilty? Write a short paragraph that gives sufficient
details to defend your answer.
The Suspect had the victim’s blood on his clothes. From looking at the electrophoresis data there
is a complete match between the victim’s blood and the blood from the defendants shirt. The
defendant should be found guilty.
4. In the RFLP method, why is the DNA denatured after transfer to a membrane?
This denaturation/blotting procedure is known as a "Southern blot" after the inventor,
Edwin Southern. Just as the blotting of wet ink on a dry paper transfers a replica of the
image to the paper, the blotting of DNA to a nylon membrane preserves the spatial
arrangement of the DNA fragments that existed after electrophoresis.
5. In the RFLP method, how do the bands on the final X-ray film differ from those in the
original gel?
They are now marked with radioactive probes.
6. Joe and Sam were adopted as infants into different families. They have just met and
noticed how much they look alike. They are also the same age and suspect that they are
twins who were separated at birth. They wish to know the truth, so have their DNA
analyzed. Study this DNA fingerprint (RFLP method) and answer the following questions:
a) In the last column of the DNA fingerprint, what does “frequency of occurrence” mean?
How often in a popluation this marker occurs.
b) What is the probability that Joe and Sam are not twins (i.e., that the DNA in the fingerprints
could have come from unrelated men)? Show your calculations.
6.61x10-8 that they are not twins
c) If there are 270,000,000 Americans, how many of them would be expected to have this DNA
fingerprint? Show your calculations.
~18 people
7. True/false
Indicate whether each of the following is a reason why the PCR method of DNA fingerprinting is
now the method of choice in forensic science (as compared to the RFLP method). Write true or
false in each blank.
__T___ The PCR method is faster.
___T__ The PCR method requires less DNA.
__T___ The PCR method uses STR regions to determine differences in the
DNA from different individuals.
Answer the following questions in complete sentences.
1. Name three ways DNA fingerprinting is used.
paternity tests
missing persons
suspects in crimes
2. How are restriction enzymes named?
Are used to cut the DNA into fragments when it recognizes a specific sequence of bases
3. What do bacteria use restriction enzymes for?
Recombinant DNA
4. Which restriction enzyme from the table will cut the following strand of DNA? Indicate with arrows
where the enzyme will cut.
5’ – AATGAATTCAATGGAATTCGAACTATGAACGCGTA – 3’
3’ -TTACTTAAGTTACCTTAAGCTTGATACTTGCGCAT – 5’
5. How many pieces will it be cut into?
4 pieces
6. Draw the resulting fragments.
5’ – AATG AATT CAATGG AATT CGAACTATGAACGCGTA – 3’
3’ –TTAC TTAA GTTACC TTAA GCTTGATACTTGCGCAT – 5’
7. What separation technique is used for the fragmented DNA?
Gel Electrophoresis
8. What causes the fragments to migrate through the gel?
size and charge
9. List the five steps in the DNA fingerprinting procedure.
-isolating DNA/PCR
-use of restriction enzymes
-Adding probes
-Gel electrophresis
10. What technology is utilized such that as little as a single molecule of DNA can be tested?
PCR So that we can copy and make a larger sample