Supplemental methods
Lymphoblast tissue culture
B-lymphoblast cell lines GM17726, GM16348, GM16351 and GM16352 were purchased from the
Coriell Institute. Cells were grown in suspension in T25 tissue culture flasks in RPMI-1640 with 120
U/ml penicillin, 120 µg/ml streptomycin, 2 mM L-Gln and 15% FBS (all reagents from Sigma).
Genomic DNA for SSLP and methylation assays was isolated using standard methods 1.
Agarose plug preparation, digests and PFGE
Protocol was adapted from the Leiden FSHD Genotyping website
(http://www.urmc.rochester.edu/fields-center/protocols/LeidenFSHDGenotyping.cfm). For PFGE,
high-molecular weight genomic DNA was embedded in agarose plugs. For this, cells were washed in
PBS, re-suspended at a concentration of 3 x 107cells per 500 µl SE buffer (75 mMNaCl, 25 mM
EDTA pH 8.0) and warmed to 60°C. 1.4% low gelling agarose was melted in SE buffer and cooled to
60°C. Equal volumes were mixed and 100 µl plugs were poured in plastic wells. Once set, plugs were
incubated for 48 hours at 37°C in 10 ml SE with 1% SDS and 0.6 mg/ml pronase (Roche). Plugs were
rinsed in water and stored in 0.5M EDTA pH 8.0 at 4°C. To digest, plugs were rinsed 2 x 1.5 hours
in TE buffer (10 mMTris-HCl pH 7.5, 1 mM EDTA pH 8.0) and equilibrated in 0.5ml restriction
enzyme buffer for 3 hours with rotation. Half a plug was digested overnight at 37°C in 150µl master
mix consisting of 15µl buffer, 1.5µl spermidine (100 mM), 1.5 µl DTT (0.1 M) and 3 µl enzyme
(10U/µl). Enzymes were purchased from Roche (EcoRI and BlnI), Fermentas (XapI) or NEB
(HindIII). Plugs were equilibrated in 1 ml of 0.5 x TBE buffer (freshly diluted from 10 x buffer: 108 g
Tris-base, 55 g boric acid and 40 ml 0.5 M EDTA pH 8.0 in 1 l water). Plugs were dry-loaded into a
0.9% TBE agarose gel. Wells were sealed with molten agarose and gel was run in a Bio-Rad Chef
Mapper in 0.5 x TBE at 14°C in two cycles of 10 hours each (1-20 seconds ramp, 6 V/cm).
Methylation assay digests and linear gel electrophoresis
Protocol was adapted from de Greefet al.2. Genomic DNA was cut in three separate overnight digests,
with standard ethanol precipitation in the morning after digests 1 and 2 to allow buffer change and
re-suspension in 100 µl nuclease-free water (NFW). First, 20 µg DNA was cut in 140 µl total volume
with 14 µl buffer O (Fermentas), 1.4 µl spermidine (100 mM) and 2 µl EcoRI (Fermentas). After cleanup, sample was digested as previously but with buffer Tango (Fermentas) and 1.2 µl of BlnI. After the
second digest and clean-up, sample was split into 2 x 50 µl and cut with FseI (2 units) or BsaAI (5
units). After the last digest, samples were run by linear gel electrophoresis on a 0.8% TAE agarose
gel (20 cm x 20 cm) with ethidium bromide for 24 hours. The Roche DIG-labeled DNA molecular
weight marker II was run as a sizing standard.
Probe preparation
The p13E-11 probe was PCR amplified (with primers by Kekouet al.3) using BiolineBioMix Red and
cloned into pGEM T-Easy. 30 pg of plasmid was used as template for probe synthesis with the Roche
PCR DIG probe synthesis kit according to manufacturer’s instructions. For the A-probe
(TGGGAATACTGAACACAGAAATGA and GCATGACAATTTCAGACTCCA), 50 pg of
construct LS1093-14 was used. All PCRs were done in 50 µl total volume with a 1:1 mix of the
supplied Roche dNTP mix and DIG-labeled dUTP mix and the following cycling conditions: 95°C 10
minutes hot-start, 10 cycles of 95°C for 30 seconds, 60°C (p13E-11) or 54.8°C (A-probe) for 30
seconds, 68°C for 30 seconds followed by 32 cycles of 98°C for 30 seconds, 60°C or 54.8°C for 30
seconds and 68°C for 45 seconds with an additional 20 seconds increase/cycle, with a final extension
step at 68°C for 15 minutes. Successful DIG-incorporation was confirmed by observing a band-shift
on electrophoresis.
Non-radioactive Southern blotting
PFGE gels were stained with ethidium bromide and photographed, rinsed 5 minutes in sterile
distilled water (SDW) and denatured 2 x 15 minutes in denaturing buffer (0.5 M NaOH, 1.5 M NaCl).
Positively charged nylon membrane (Roche) was pre-wet in denaturing buffer and DNA was
transferred overnight at room temperature (RT) in denaturing buffer using capillary transfer. The
next day, the membrane was neutralized for 5 minutes in neutralizing solution (0.5 M Tris pH 7.5
and 1.5 M NaCl), rinsed in 2 x SSC (freshly diluted from 20 x SSC: 175.3 g NaCl and 88.2 g sodium
citrate in 1 l SDW, pH 7.0 with citric acid), air dried and baked for 2 hours at 80°C. Linear gels were
photographed, denatured 2 x 15 minutes in denaturing buffer, rinsed in SDW and neutralized 2 x 15
minutes in neutralizing buffer. Capillary transfer was performed in 20 x SSC for 16 hours. The
membrane was then rinsed in 2 x SSC and baked as above. For probe detection, membranes were prewet in 2 x SSC and pre-hybridized for 30 minutes with 20 ml DIG Easy Hyb (Roche) at 42°C (p13E11) or 40°C (A-probe) in a hybridization-rotator oven. 2.5µl of the probe PCR was denatured in 50µl
SDW at 95°C for 5 minutes. Tubes were transferred to ice for 1 minute and the probe was then added
to 6 ml pre-warmed DIG-Easy Hyb (hybridization temperatures as for pre-hybridisation). Probes
were hybridized 16-20 hours in roller bottles.
For signal detection, the Roche DIG Wash and Block Buffer Set was used. The hybridized membrane
was washed with agitation for 2 x 8 minutes in post-hybridisation wash (2 x SSC, 0.1% SDS) at RT,
followed by 2 x 20 minutes at high stringency (0.5 x SSC, 0.1% SDS at 65°C). Membrane was rinsed
in 50 ml DIG washing buffer for 5 minutes and blocked with 100 ml 1 x DIG blocking solution (made
fresh from 10 x stock diluted in 1 x DIG maleic acid buffer) at RT for 30 minutes. Anti-DIG antibody
(Roche Anti-Digoxigenin-AP) was centrifuged for 5 minutes at 10,000 rpm and diluted 1:20,000 in 20
ml fresh 1 x DIG blocking solution. The membrane was incubated with antibody for 30 minutes at
RT, followed by washing for 2 x 15 minutes in 150 ml 1 x DIG washing buffer and equilibration for 5
minutes in 10 ml DIG detection buffer. Finally, the membrane was incubated 5 minutes between
Saran cling film with 1 to 2 ml of detection buffer with 1:200 CPD-star (Roche) and light signal was
detected on film or camera. For sequential hybridization of p13E-11 and A-probe, blot was stripped
with 50 ml 0.2 M NaOH with 0.1% SDS at 37°C in a roller bottle and re-hybridized as described
above.
SSLP
The length of the short sequence length polymorphism was determined by PCR followed by capillary
gel electrophoresis using the protocol of Lemmerset al.5. Our only modification was the use of a FAMlabeled primer (Sigma).
DNA shearing
Genomic DNA extracted from GM17726 lymphoblasts was quality assessed by gel electrophoresis on
a 0.8% TBE agarose gel. An observed RNA smear between 100 bp and 1000 bp was cleaned up by
treating the sample with RNAse A for 30 minutes at 37°C. Sample was quantified with the Qubit
Broad Range assay (Invitrogen) and cleaned up after sonication using the QiagenQiaQuick PCR
purification kit to eliminate RNAse A contamination. Sonication was performed on a Covaris S2
(Powermode: Frequency sweeping. Degassing mode: Continuous. Volume: 120µl. Buffer: Tris EDTA
pH 8.0. DNA mass: 3000 ng. AFA Intensifier: Yes. Water fill level: 12. Vessel: Snap-Cap microTUBE
with AFA fiber and pre-split septa. Temperature: 6°C water bath. Duty cycle: 10. Intensity: 4.
Cycles/burst: 200. Time: 160 seconds). This sheared the DNA to a mean size of 250 bp for later 100
bp paired-end sequencing.
Exome capture
Exome capture was performed according to the Agilent SureSelect Target Enrichment System for
the Illumina Paired-End Multiplexed Sequencing Library 1.2. Fragment end-repair, adenine-tailing
and adaptor ligation was done with the Beckman Coulter SPRI-Works robot with bead size selection
(200-400 bp). The sample was indexed with oligo number 12 from the Illumina Multiplex Sample
Prep Oligo Kit PE-400-1001. Successful adaptor ligation was confirmed on a Bioanalyzer chip
followed by PCR for 7 cycles; a total yield of 1167 ng was confirmed by Qubit HS and under-curve
integration on a Bioanalyzer chip. 500 ng was used for exome bait capture. Captured DNA was
amplified with 17 cycles, which yielded a total of 42.6 ng library. Samples were paired-end sequenced
on an Illumina HiSeq2000.
Data processing and analysis
Raw reads were de-multiplexed, converted into Sanger Fastq quality format and quality controlled
with FastQC (http://www.bioinfor
matics.bbsrc.ac.uk/projects/fastqc/). Data was processed on a desktop iMac running a combination of
freely available open-source tools6-9. Command line calls to all of these tools were processed
sequentially using a custom Perl pipeline. Table S1 shows the sequence of processing with all
command line arguments and parameters (file names are shortened for clarity). Alignment statistics
were generated using unixgrep, awk and Bedtools10. Figures S2B and S2C show how the recalibration
of the fastq quality scores corrects the systematic scoring bias of the Illumina platform. Variants that
passed the quality filter were annotated with SeattleSeq
(http://snp.gs.washington.edu/SeattleSeqAnnotation/) and processed with Excel spreadsheets and
Perl scripts.
Sanger sequencing
Primers to sequence the two identified CAPN3 mutations were designed using Primer3
(http://frodo.wi.mit.edu/primer3/). Primer sequences available on request. PCR products were
cleaned with Sigma spin columns and sequenced directly with the BigDye Terminator 3.1 Cycle
Sequencing system (Applied Biosystems).
RT-PCR
GM17726 lymphoblasts were grown as above. 1 x 107cells were pelleted, total cellular RNA was
extracted with TRIzol (Invitrogen) and 10µg of RNA was DNAase treated with the TURBO DNAfree kit (Ambion) according to manufacturers’ instructions. cDNA was synthesized from 2 µg RNA
using the Superscript III system (Invitrogen) with 0.5 µg random primers (Invitrogen) in 1 st-strand
synthesis buffer according to the Superscript III manual. CAPN3 exons 3 – 13 were amplified with
BioMix Red (Bioline) as a single product of 1098 bp.The product was gel extracted, cloned into
pGEM T-Easy (Promega) and sequenced with vector and PCR primers.Primer sequences available
on request.
Supplemental figures and table
Figure S1
D4Z4 alleles in CoriellInstitute samples GM16348, GM16351 and GM16352.
A) The two affected siblings GM16348 and GM16351 both share the same small chromosome 4
fragment (*). GM16351 also carries another short 4q allele, which could potentially also be
pathogenic. Their unaffected sister GM16352 does not carry the short chromosome 4 fragment
shared by her siblings, although she does carry a third short 4q allele. B) SSLP capillary sizing.
Unlike her affected siblings, GM16352 does not have a FSHD-permissive 161 allele. This explains
why her short chromosome 4 is not pathogenic.
Figure S2
A) Plots show the systematic quality score bias for dinucleotide combinations. Before correction (left
panel), some combinations of dinucleotides lead to systematic over-estimation (e.g. GG) or underestimation (e.g. AG) of base quality. Right panel shows that after correction, the reported quality
score is much closer to the empirical quality (which considers known Illumina sequencing bias). B)
Panels show the overall improvements of quality score recalibration for the GM17726 reads.
Table S1
The actual file names have been substituted with descriptive names.
References
1. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from
human nucleated cells. Nucleic Acids Res. 1988;16(3):1215-15.
2. de Greef JC, Lemmers RJL, van Engelen BGM, Sacconi S, Venance SL, Frants RR, et al.
Contraction-dependent (FSHD1) and independent (FSHD2) epigenetic changes of D4Z4
unify FSHD. Neuromuscul. Disord. 2009;19(8-9):545-45.
3. Kekou K, Fryssira H, Sophocleous C, Mavrou A, Manta P, Metaxotou C. Facioscapulohumeral
muscular dystrophy molecular testing using a non radioactive protocol. Mol. Cell. Probes
2005;19(6):422-24.
4. van Geel M, Dickson MC, Beck AF, Bolland DJ, Frants RR, van der Maarel SM, et al. Genomic
analysis of human chromosome 10q and 4q telomeres suggests a common origin. Genomics
2002;79(2):210-17.
5. Lemmers R, Wohlgemuth M, van der Gaag KJ, van der Vliet PJ, van Teijlingen CMM, de Knijff P,
et al. Specific sequence variations within the 4q35 region are associated with
Facioscapulohumeral muscular dystrophy. Am J Hum Genet 2007;81:884-94.
6. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, et al. The Sequence Alignment/Map
format and SAMtools. Bioinformatics 2009;25(16):2078-9.
7. DePristo MA, Banks E, Poplin R, Garimella KV, Maguire JR, Hartl C, et al. A framework for
variation discovery and genotyping using next-generation DNA sequencing data. Nat. Genet.
2011;43(5):491-8.
8. McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A, et al. The Genome
Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing
data. Genome Res. 2010;20(9):1297-303.
9. Li H, Durbin R. Fast and accurate long-read alignment with Burrows-Wheeler transform.
Bioinformatics 2010;26(5):589-95.
10. Quinlan AR, Hall IM. BEDTools: a flexible suite of utilities for comparing genomic features.
Bioinformatics 2010;26(6):841-2.