Supplementary Materials for
Rapid and marker-free Cas9/CRISPR refactoring yields equivalent xyloseutilization performance in yeast
Ching-Sung Tsai1, In Iok Kong2, Anastashia Lesmana2, Gyver Million2, Guo-Chang
Zhang1, Soo Rin Kim1 and Yong-Su Jin1,2
Institute for Genomic Biology1 and Department of Food Science and Human Nutrition2,
University of Illinois at Urbana-Champaign, Urbana, IL 61801
This PDF file includes:
Protocol to rapidly construct a xylose-fermenting yeast strain
Supplementary Figures 1, 2, and 3.
Protocol to rapidly construct a xylose-fermenting yeast strain
In this protocol we demonstrate the detailed steps for constructing a xylose-fermenting
yeast strain using a Cas9-directed method. The replacement of PHO13 and ALD6 was
done consecutively with the DNA assembler technique, Method B, mentioned in the text.
The final strain will contain 1 copy of XYL123 in each locus, hence resulting in 2 copies
of XYL123 in the genome.
REAGENTS
 Yeast recipient strain: haploid strain with auxotrophic markers being complemented,
for example, D452-2 (MATα leu2 his3 ura3) serially transformed with S288C wildtype LEU2, HIS3 and URA3 PCR fragments and can grow on SD-Leu-His-Ura
medium plates. The strain also needs to be transformed with pCas9-NAT
 E. coli strains carrying required plasmids: Top10 (pSR6-X123), Top10 (pCST154),
Top10 (pCST155)
 Top10 (pCas9-NAT), Top10(pSR6-X123), Top10(pCST154) and Top10(pCST155)
are all available from Dr. Ching-Sung Tsai (ctsai007@illinois.edu)
 Primers: 25 pmol/ml in H2O (Integrated DNA Technologies), see supplementary
Table 1.
 LongAmp™ Taq 2X Master Mix (NEB, cat no. M0287S)
 SYBR Safe DNA gel stain (Life Technologies, cat. no. S33102)
 50× TAE buffer (VWR International, cat. no. 97063-692)
 Agarose (Fisher Scientific BP1356-100)
 QIAquick PCR purification kit (Qiagen, cat. no. 28106)
 Lithium acetate dihydrate (Sigm-Aldrich, cat. no. L-6883)
 PEG 3350 (Sigma-Aldrich, cat. no. P-3640)
 Salmon sperm DNA (Sigma-Aldrich, cat. no. D-1626)
 D-Dextrose (glucose) (Sigma-Aldrich, cat. no. G8270)
 D-Xylose (Acros-Organics, cat. no. 141000025)
 BactoTM Yeast Extract (BD Biosciences, cat. no. 212750)
 BactoTM Peptone (BD Biosciences, cat. no. 211677)
 BactoTM Agar (BD Biosciences, cat. no. 214010)
 Autoclaved sterile distilled water
 Nourseothricin (Gold Biotechnology, cat. no. N-500-5)
 Hygromycin B (Sigma-Aldrich, cat. no. H3274-1G)
 Ampicillin (Sigma-Aldrich, cat. no. A0166)
EQUIPMENT
 PCR machine Any brand that can perform touchdown, gradient, and individual
stage time extension programs.




Incubation Shaker Any brand that can perform adjustable shaking speeds and
temperature control at 30 or 37 °C
Spectrophotometer Functional at measuring OD600
Nanodrop spectrophotometer Nanodrop, ND-1000
HPLC Agilent 1200 series high-performance liquid chromatography system
equipped with a Rezex ROA Organic Acid H+ (8%) column
REAGENTS SETUP
 5X YE medium Prepare the mixture of 20 g BactoTM Yeast Extract and 40 g BactoTM
Peptone, then add water to 400 mL. Autoclave and cool down.
 20% Glucose Mix 200 g glucose and bring up the volume to 1000 mL with water,
autoclave.
 40% Xylose Mix 400 g xylose and bring up the volume to 1000 mL with water,
autoclave
 YPD20 medium Add 10 mL of 5X YE medium, 5 mL of 20% glucose and bring up
the volume to 50 mL with autoclaved water.
 YPX40 medium Add 10 mL of 5X YE medium, 5mL of 40% xylose and increase the
volume to 50 mL with autoclaved water.
 YPD20 agar Mix 4 g BactoTM Yeast Extract , 8 g BactoTM Peptone and 8 g BactoTM
Agar, bring the volume to 400 mL with water. Autoclave, cool down to 55 °C and add
appropriate antibiotics. Then plating.
 Transformation reagents 50% PEG3350, Lithium Acetate and Single-Stranded
DNA Follow the high-efficiency yeast transformation protocol (Gietz and Schiestl
2007).
Supplementary Table 1 Primers used to amplify the XYL123 cassette and check the
successful insertions.
Primers
Sequences
PHO-XYL-F
TAATCGTATATTAATGACGTCCCTTATCTATTAACTTTCCGTA
AAACGACGGCCAG
PHO-XYL-R
AGGTGTAGATGTCACCAAGTTTATCAATGTAAAATTTAGGCA
GGAAACAGCTATGAC
XYL3-F
TGAGATCAAAGCATCATTT
XYL3-R
GAATCACCTCCATTGAAGAG
ALD-XYL-F
TCAAGAAACATCTTTAACATACACAAACACATACTATCAGGT
AAAACGACGGCCAG
ALD-XYL-R
GGTTGGTACATTACAACTTAATTCTGACAGCTTTTACTTCCA
GGAAACAGCTATGAC
PHO13-Check-F
CTGTTACTGTGATACTAACGGGC
PHO13-Check-R
ATCGACCAGGCACAAACAAC
ALD6-Check-F
CGTTTTGGGCATCGGGAAC
ALD6-Check-R
Cassette 3’-F
TTTTACGTAGATCTCTGGGCAAC
GGTACCAGCTTTTGTTCCCT
PROCEDURE
I. Plasmids and PCR products preparation for PHO13 replacement transformation
(TIMING 2 days)
Day 1
Culture the yeast recipient strain in 5 mL of YPD medium with nourseothricin (100
μg/mL). Also prepare the cultures of E. coli strains Top10 (pSR6-X123),
Top10(pCST154), Top10(pCST155) with LB medium plus ampicillin (100 μg/mL).
Day 2
1) In the morning, measure the cell density (OD600) of the yeast recipient strain.
Reinoculate the cells into 25 mL of YPD20 with an initial OD600 of 0.1. The culture
will grow for 6 hours for transformation (Gietz and Schiestl 2007).
2) Purify plasmids pCST154, pCST155 pSR6-X123, use Nanodrop ND-1000 to
measure the DNA concentrations.
3) Set up PCR reactions using LongAmp Taq 2X Master Mix to amplify XYL123
cassette with primers containing PHO13 40 bp upstream and downstream
homologous sequences (Primer PHO-XYL-F paired with XYL3-R, XYL3-F paired
with PHO-XYL-R, each set is prepared with six 50 μL reactions), assemble the
reactions by pipetting:
Component
LongAmp Taq 2X Master Mix
50 μM forward primer
50 μM reverse primer
pSR6-X123
Nuclease-free water
Total
Volume (μL)
25
2
2
1
20
50
The PCR program:
Stages Purpose
Activation
Touch-Down
Cycles
1
15
Gradient
20
Final extension
1
Final Concentration
1X
2 μM
2 μM
Variable
̶
Conditions
94 °C 2 min
94 °C 30 sec
65 to 50 °C 1min
65 °C 5 min
94 °C 30 sec
Gradient 50 °C to 65 °C
65 °C 5 min, each cycle
with 10 sec increment
65 °C 10 min, then 4 °C
cool down
4) Check PCR results on an agarose gel with the addition of SYBR Safe DNA gel stain
to confirm the amplification of DNA assembler fragments PHO13-XYL Fragment 1
and PHO13-XYL Fragment 2.
5) Precipitate the remaining volume of PCR reactions together with ethanol or purify
the fragments by using a QIAquick PCR purification kit. Measure the DNA
concentrations, usually a concentration of more than 500 ng/μL is expected for 6
tubes of PCR reactions.
6) Measure the cell densities of cultures set up in the morning (Day 2 step (1), target
OD600 is about 0.3-0.5) and collect the cells according to the high-efficiency yeast
transformation protocol (Gietz and Schiestl 2007). Assemble the transformation
reactions as follows:
Transformation mix components
PEG 3350 (50% (w/v)
Single-stranded carrier DNA (2.0 mg/L)
LiAc 1.0 M
Guide RNA Plasmid and DNA fragments
Guide RNA Plasmid pCST155
PHO13-XYL Fragment 1
PHO13-XYL Fragment 2
Volume (μL)
240
50
36
34
to 2 μg
to 2 μg
to 2 μg
Total
360
7) For the control, exclude the DNA assembler fragments and only add gRNA plasmid.
Heat shock the transformation mix at 42 °C for 40 min. After that, pellet the cells and
remove the transformation mix by centrifugation. Add 300 μL of YPD20 medium into
each reaction to outgrow for 1 hour at 30 °C. Collect the cells and plate on YPD20
agar with both 100 μg/mL nourseothricin and 300 μg/mL hygromycin B.
II. Verification of PHO13 replacement mutants (TIMING 7 days)
Day 3
While waiting for yeast colonies to form on plates, this day can be used to amplify the
XYL123 cassette flanked with ALD6 upstream and downstream homologous sequences.
The method is the same as Day 2 step (3) except that the following PCR primer pairs
will be used: ALD-XYL-F paired with XYL3-R, XYL3-F paired with ALD-XYL-R. The
DNA assembler fragments are called ALD6-XYL Fragment 1 and ALD6-XYL Fragment
2.
Day 4
Yeast transformants should already appear on the plates. Check whether the control
plates have fewer colonies than the plates with PHO13 replacement DNA fragments.
Pick up twenty-four colonies and grow each in 2 mL YPD20 medium with 100 μg/mL
nourseothricin. Grow the cells aerobically at 30 °C with a 200 rpm shaking speed. The
cultures serve two purposes: to drop out the guide RNA plasmid pCST155, which has
the hygromycin marker; and to test the xylose aerobic utilization abilities confirming the
correct replacement of PHO13 with the XYL123 cassette.
Day 5
For the twenty-four YPD20 cultures prepared yesterday, remove the YPD20 medium by
low speed centrifugation. Resuspend the cells in 2 mL of YPX40 medium with 100
μg/mL nourseothricin. Culture overnight aerobically at 30 °C with a 200 rpm shaking
speed.
Day 6
After 24 hours of growth, measure remaining xylose concentrations of the twenty-four
YPX40 cultures by HPLC. Pick the best one or two strains. From the best culture, dilute
and spread or streak on YPD20 agar plates with 100 μg/mL nourseothricin to obtain
single colonies.
Day 7
Wait for the appearance of single colonies.
Day 8
Pick up the single colonies and make patches on YPD20 agar plates with 100 μg/mL
nourseothricin OR 300 μg/mL hygromycin.
Day 9
1) Pick up the strains which lose the growth on hygromycin plates but retain growth on
nourseothricin plates.
2) Conduct colony PCR to confirm the insertion of XYL123 into PHO13. Prepare DNA
by picking up colonies into 20 μL of 10 mM NaOH inside Eppendorf tubes and
microwave the tubes uncapped for 2 minutes. Primers used for checking the
XYL123 insertion are PHO13-Check-F paired with XYL3-R, PHO13-Check-R paired
with Cassette 3’-F. Use LongAmp Master Mix with the following touchdown-gradient
PCR program with a 10 min activation stage:
The PCR program:
Stages Purpose
Activation
Touch-Down
Cycles
1
15
Conditions
94 °C 10 min
94 °C 30 sec
65 to 50 °C 1min
65 °C 5 min
Gradient
15-25
Final extension
1
94 °C 30 sec
Gradient 50 °C to 65 °C
65 °C 6 min, each cycle
with 10 sec increment
65 °C 10 min, then 4 °C
cool down
Positive insertions of the XYL123 cassette into PHO13 site should be detected with a
PCR product of 4539 bp in length if primers PHO13-Check-F and XYL3-R are used.
Instead, a PCR product of 712 bp will be produced if primers PHO13-Check-R and
Cassette 3’-F are used.
After PCR confirmation, pick up colonies and grow in YPD20 medium with 100 μg/mL
nourseothricin.
This is the new recipient strain and will be used for the next gene replacement at the
ALD6 locus.
III. ALD6 replacement with XYL123 cassette (TIMING 3 days)
Day 10
1) In the morning, measure the cell density (OD600) of the new recipient strain (should
be PHO13::XYL123 carrying plasmid pCas9-NAT). Reinoculate the cells into 25 mL
of YPD20 broth with an initial OD600 of 0.1. Grow the cells for about 6 hours
according to the high-efficiency yeast transformation protocol (Gietz and Schiestl
2007).
2) Six hours later, measure the cell densities of cultures set up in the morning (Target
of OD600 is about 0.3 to 0.5) and collect the cells according to the high-efficiency
yeast transformation protocol (Gietz and Schiestl 2007). Assemble the
transformation reactions as follows:
Transformation mix components
PEG 3350 (50% (w/v)
Single-stranded carrier DNA (2.0 mg/L)
LiAc 1.0 M
Guide RNA Plasmid and DNA fragments
Guide RNA Plasmid pCST154
ALD6-XYL Fragment 1
ALD6-XYL Fragment 2
Volume (μL)
240
50
36
34
to 2 μg
to 2 μg
to 2 μg
Total
360
3) For the control, exclude the DNA assembly fragments, only add gRNA plasmid
pCST154. Heat shock the transformation mix at 42 °C for 40 min. After that, spin
down the cells and remove the transformation mix. Add 300 μL of YPD20 medium
into each reaction and outgrow the cells for 1 hour at 30 °C. Collect the cells and
plate on YPD20 agar with 100 μg/mL nourseothricin and 300 μg/mL hygromycin.
Day 11
Wait for the appearance of single colonies.
Day 12
Single colonies should appear on YPD20 plates. Pick colonies to check the integration
of XYL123 cassette into the ALD6 locus. Prepare DNA as mentioned in Day 9 above.
Primers used for checking are ALD6-Check-F paired with XYL3-R, and ALD6-Check-R
paired with Cassette 3’-F. Use LongAmp Master Mix with the touchdown-gradient PCR
program with a 10 min activation stage.
The PCR program:
Stages Purpose
Cycles
Conditions
Activation
1
94 °C 10 min
Touch-Down
15
94 °C 30 sec
65 to 50 °C 1min
65 °C 5 min
Gradient
15-25
94 °C 30 sec
Gradient 50 °C to 65 °C
65 °C 6 min, each cycle
with 10 sec increment
Final extension
1
65 °C 10 min, then 4 °C
cool down
Positive insertions of the XYL123 cassette into the ALD6 locus should be detected by a
PCR product of 4168 bp in length if primers ALD6-Check-F and XYL3-R are used.
Instead, a 860 bp fragment would be amplified if primers ALD6-Check-R and Cassette
3’-F are used.
After PCR confirmation, colonies are picked up and grow in YPD20 broth for further
storage and verification of xylose micro-aerobic or anaerobic fermentation capabilities.
References
Gietz RD, Schiestl RH. 2007. High-efficiency yeast transformation using the LiAc/SS carrier
DNA/PEG method. Nat Protoc 2(1):31-4.
Supplementary figures
Supplementary Figure.1
Xylose fermentation metabolite profiles of DX123, CT1b-1 and CT2-Pro strains under
40 g/L xylose (YPX40) and oxygen-limited conditions. Open square: DX123; Filled circle:
CT1b-1; open triangle: CT2-auxo.
Supplementary Figure.2
Xylose fermentation metabolite profiles of SR8 and CT2-Pro strains under 40 g/L xylose
(YPX40) and oxygen-limited conditions. Open square: SR8; Filled circle: CT2-Pro.
Supplementary Figure.3
Fermentation metabolite profiles of SR8 and CT2-Pro strains with70g/L glucose and 40
g/L xylose (YPD70X40) under anaerobic conditions. Open square: SR8; Filled circle:
CT2-Pro.