Supplemental Information
EXPERIMENTAL PROCEDURES
Cells and Reagents- Peripheral blood mononuclear cells (PBMCs) were acquired from consenting
CLL patients at the Moores Cancer Center at the University of California San Diego (UCSD) in
compliance with the Declaration of Helsinki and the institutional review board of UCSD. PBMCs
were isolated from blood by Ficoll-Paque (GE Healthcare) density gradient centrifugation as
previously described (16). Ramos cells were acquired from ATCC. EHEB cells were a gift from
Dr. Paul Insel at UCSD and WaC3CD5+ cells were generated by Dr. John Byrd at Ohio State
University.
DNA and RNA Isolation- Prior to DNA and RNA isolation, CLL B cells were purified from
PBMCs by negative selection using magnetic associated cell sorting (MACS) (Miltenyi Biotec) to
remove CD14+ monocytes and CD2+ T cells, leading to >99% CLL cell purity. Normal B cells
were purified from PBMCs of healthy donors (San Diego Blood Bank) using the MACS B cell
Isolation Kit II and were determined to be >90% pure by flow cytometry analysis (CD19+/CD3/CD14- cells). Cell lysates were homogenized with QIAshredders prior to DNA and RNA
isolation using the AllPrep DNA/RNA mini kit (Qiagen).
Quantitative PCR- One microgram of RNA was reverse transcribed using the High Capacity
cDNA Reverse Transcription Kit (Applied Biosystems). The cDNAs generated were then
analyzed in triplicates using SYBR-Green PCR mix (Applied Biosystems). All values were
normalized to GAPDH expression. Primers used are as follows: GAPDH (Forward 5’GAGAGACCCTCACTGCTG-3’, Reverse 5’- GATGGTACATGACAAGGTGC -3’), PHLPP1
(Forward 5’- ACTGGGATTTGGGGAGCTG -3’, Reverse 5’- CGTCTTGTCCATCGGTTCACT
-3’)
and
PHLPP2
(5’-
ATGGAGCAGACACTACCACTG
-3’,
Reverse
5’-
GCAAAGGACGAGATGTAAGTCA -3’. Quantitative PCR experiments were performed using
the 7500-Fast Real-time PCR system (Applied Biosystems) and relative mRNA concentrations
were calculated by the 2-ΔΔCt method, where Ct is the mean threshold cycle value and GAPDH
was used to normalize.
Adenoviral Infection of CLL Cells- The PHLPP1 adenoviral construct was provided by Dr. Joan
Heller Brown and prepared by Dr. Atsushi Miyanohara at the UCSD Viral Vector Core. Fresh
CLL PBMCs were infected in 50 μl drops at 5x107 cells/mL at an MOI of 300 pfu/cell and
incubated for 2 h at 37°C/5%CO2. Following adenoviral infection, CLL cells were resuspended at
1x107 cells/mL in RPMI + 10% heat inactivated serum and cultured for 72 h in plates containing
a 3T3 fibroblast layer at ~70% confluence.
CXCL12 Stimulation, Protein Lysates and Western Blots- Western blot lysates from purified CLL
B cells were prepared using ice cold RIPA buffer as previously described (21). CLL cells infected
with adenoviral-GFP or adenoviral-PHLPP1 for 72 h were cultured in serum-free RPMI at 1x107
cells/ml for 4 h at 37°C/5%CO2 and then stimulated with 30 nM CXCL12 over an hour time
course. CXCL12 used for stimulations was expressed recombinantly in BL21 E. coli as
previously described (22). Total protein concentrations were determined by a BCA protein assay
(Thermo Scientific) and western blots were performed as previously described (21). PHLPP1 and
PHLPP2 (PHLPPL) antibodies were obtained from Bethyl Laboratories, phospho-ERK1/2 and
ERK1/2 antibodies were from Upstate, PKC antibodies were from Santa Cruz, and all other
antibodies were acquired from Cell Signaling Technology. Densitometry analysis was performed
using ImageJ software (NIH) and normalized to β-actin loading controls.
Bisulfite DNA Conversion and Sequencing- Genomic DNA (500 ng) was bisulfite converted
using the EZ DNA Methylation Kit (Zymo Research). PCR amplification of bisulfite-converted
DNA was carried out using Hot Start Taq (Qiagen) in 1x reaction buffer, 250 μM dNTP mix, 1
μM of each primer, 2.5 mM MgCl2, and 5% DMSO. Primers used to probe the region of interest
of
PHLPP1
are:
Forward
5’-GAGGGTTATTGATAGTT-3’
and
Reverse
5’-
CAAAACAAATAACTTCCTTACC-3’. Primers used to probe the PHLPP1 promoter and other
CpG regions in exon 1 are included in Supplemental Figure 7. The PCR reactions were performed
under the following conditions: 95°C for 15 min, then 40 cycles of 95°C for 1 min, 58°C for 1
min, and 72°C for 1 min, followed by 72°C for 7min. PCR products were gel purified (Qiagen gel
extraction kit) and cloned into a TOPO/TA vector (Invitrogen). For each patient DNA sample, 510 colonies were sequenced and the fraction of methylated CpGs was calculated across the entire
region. As a positive control for bisulfite conversion, in vitro methylation of DNA using SSSI
(New England Biolabs) was performed. DNA sequencing was performed by the DNA
Sequencing Shared Resource, UCSD Cancer Center, which is funded in part by NCI Cancer
Center Support Grant # 2 P30 CA023100-23.
Analysis of PHLPP1 mRNA Stability and Inhibition of DNA Methylation- To assess PHLPP1
mRNA stability, cells were treated with 5 μg/mL of Actinomycin D (Calbiochem) and RNA was
harvested at 0, 2, and 4 h following treatment (levels stabilized after 4 h). Reverse transcription
and quantitative PCR was carried out as described above and values were normalized to GAPDH
levels. To examine the effects of DNA methylation on PHLPP1 mRNA expression, EHEB and
Ramos cell lines were left untreated or treated with 5-aza-2’-deoxycytidine (5-aza DC) (Sigma)
(0 to 25 μM) for 72 h. RNA isolation, cDNA synthesis, and quantitative PCR were performed as
described above.
DNA sequencing for mutations- The primers used to amplify the genomic regions of PHLPP1
were designed using Primer 3, to cover the exonic regions plus at least 50 bp of intronic
sequences on both sides of intron-exon junctions (Supplemental Table 2). The PCR reactions
were carried out using the Hotstart Kapa Fast Taq kit (Kapa Biosystems). DNA sequencing was
completed by the UCSD cancer center shared DNA sequencing resource (see above) using
primers listed in Supplemental Table 3.
Flow Cytometry- Cells (~500,000) were stained for CXCR4 expression using a PE-conjugated
antibody (BD Pharmingen) or corresponding PE-conjugated IgG isotype control (BD
Pharmingen) in 100 μl of 0.5% BSA-PBS. CD19-APC, CD3-PE, and CD14-Fluorescein
antibodies were obtained from R&D systems. Flow cytometry data was collected on a
FACSCalibur cytometer (BD Biosciences) and analyzed using FlowJo software.
SUPPLEMENTAL DATA
Supplemental Table 1. DNA sequencing analysis of PHLPP1. Detailed information
regarding the DNA changes of PHLPP1 including: the PCR reaction that covered the sequence
(Rxn #), the NCBI reference number from the SNP database (NCBI ref #), the chromosome 18
genomic contig number from the GCRh37.p2 reference primary assembly (Contig #), and
genotype frequency in our sample group (Frequency).
Supplemental Table 2. List of sequencing reactions performed to cover the PHLPP1 gene
including the PHlPP1β extension. The PCR additives 1M betaine (B) and 5% DMSO (D) were
included for the indicated reactions and the primers used for the sequencing reactions are also
shown.
Supplemental Table 3. Sequence of primers used for amplification and sequencing of
PHLPP1. Forward (F) and Reverse (R) PCR primers for sequencing the PHLPP1 gene.
Abbreviations include the following: NF= Nested Forward, BF= Beta Forward, BR= Beta
Reverse, and BSEQ1 and 2 are the primers for sequencing the PHLPP1β region.
Supplemental Figure 1. PHLPP1 protein expression correlates with mRNA expression
levels in B cell leukemia/lymphoma cell lines. Western blot of relative PHLPP1 protein
expression in a Ramos Burkitt’s lymphoma line and two CLL cell lines, EHEB and
WaC3CD5+ cells (top panel) and corresponding relative mRNA expression as assessed by
quantitative RT-PCR (bottom panel).
Supplemental Figure 2. PHLPP1 over-expression reduces basal and CXCL12-induced
Akt phosphorylation (S473) in WaC3CD5+ cells. Western blot comparing phospho-Akt
(S473) at 0, 3 and 15 min after 30 nM CXCL12 stimulation in adenoviral PHLPP1 or
adenoviral GFP transduced WaC3CD5+ cells. β-actin served as a loading control and GFP
and PHLPP1 panels demonstrate successful adenoviral transduction.
Supplemental Figure 3. Relative amount of CpG methylation across regions of the bisulfite
converted PHLPP1 gene and promoter. DNA sequence of bisulfite converted PHLPP1 gene and
promoter. Boxed sequences indicate the primers used to probe these regions (forward and
reverse) and the red highlight indicates the ATG start site. Highlighted regions represent: whitenot probed, yellow- <15% CpG methylation across the region, green- >30% CpG methylation
across the region, blue- >20% CpG methylation across region and this is the region used in
quantitative analysis. In vitro DNA methylation using Sss1 (NEB) performed as a positive control
results in ~45-50% CpG methylation across these regions.
Fold change in PHLPP2 mRNA
PHLPP2 mRNA Levels
1.5
1.0
0.5
0.0
0
0.5
5
25
Concentration 5-Aza DC (M)
Supplemental Figure 4. PHLPP2 transcript levels are not changed following treatment with
5-aza DC. EHEB cells were treated with varying concentrations of 5-Aza DC from 0.5-25 μM or
DMSO control for 72 h and the levels of PHLPP2 mRNA were compared by quantitative RTPCR. Values were normalized to GAPDH and results indicate fold changes in PHLPP2 mRNA
levels.
% Viability
(based on Trypan Blue stain)
VPA treatment of CLL cells
100
80
60
40
** p<0.001
20
0
DMSO control
10 mM VPA
Supplemental Figure 5. Viability of CLL cells following treatment with VPA. Purified CLL
cells from 2 patients were treated with 10 mM (on right) and 20 mM (not shown) VPA or DMSO
control (on left) and cultured for 72 h. Cell viability was measured based on cell count and
trypan blue staining (% viability= non blue cells/total number of cells). Statistical significance
was calculated based on a student’s t-test (mean +/- SD).
Relative mRNA levels
Relative transcript stability
1.0
CLL PHLPP1
CLL PHLPP2
0.8
0.6
0.4
0.2
0.0
0
1
2
3
4
Time Actinomycin D (h)
5
Supplemental Figure 6. Relative transcript stability of PHLPP1 and PHLPP2 in CLL cells
following treatment with Actinomycin D. Relative levels of PHLPP1 and PHLPP2 mRNA at 0 h,
2 h, and 4 h following 5 μg/mL Actinomycin D treatment were compared by quantitative RTPCR in CLL cells expressing low but detectable PHLPP1 mRNA. Data represents average from
3 different CLL patients. Experiments were performed in triplicate. Error represents the
standard deviation of the mean.
Supplemental Figure 7. Primers used to PCR amplify regions of bisulfite converted PHLPP1 gene and
promoter. DNA sequence of bisulfite converted PHLPP1 gene and promoter (assuming CpG sites are methylated
and retained) (left). Boxed sequences indicate the primers used to probe these regions (forward = odd number and
reverse = even number primers) and the red highlight indicates the ATG start site. The primer sequences, listed in
pairs of forward and reverse primers for different PCR amplifications, are shown on the right.