Supplementary Material
Preparation of Small RNA Using Rolling Circle Transcription
and Site-Specific RNA Disconnection
Xingyu Wang, Can Li, Xiaomeng Gao, Jing Wang and Xingguo Liang,*
College of Food Science and Engineering, Ocean University of China, Qingdao, 266003, China.
* To whom correspondence should be addressed. Tel: +86 532 82031086; Fax: +86 532 82031086; Email:
liangxg@ouc.edu.cn
Content
1. Preparation of circle markers and cleavage of DNA/RNA chimeric oligomer ….………....1
2. Purification of RCT-SSD synthesized RNA oligomers..…………………………………....3
3. Stem-loop RT-qPCR for quantifying synthesized RNA oligomers……….…………….......4
4. Supplementary results.............................................................................................................5
1. Ligation of circle markers and cleavage of DNA/RNA chimeric oligomer
Materials: All oligonucleotides used as cDNA, splint, Aid-DNA were synthesized and purified by
Sangon Biological Engineering Technology (Shanghai, China). FITC modified DNA/RNA chimeric
oligomers were obtained from Genescript Biotechnology (Nanjing, China). The chemical synthesized
mir-16 RNA oligomer was purchased from Integrated DNA Technologies (Coralville, USA). T4 DNA
Ligase,
Exonuclease
I,
T7
RNA
polymerase,
RibolockTM
RNase
inhibitor,
RNase
H,
Deoxyribonucleotides (dNTPs), RNase free water and ultralow range RNA ladder were purchased from
Thermo Scientific (Beijing, China). Inorganic pyrophosphatase and M-MulV reverse transcriptase were
provided by New England Biolabs (Beijing, China). Recombinant DNase I (RNase-free) was
purchased from Takara Biotechnology CO., LTD. (Dalian, China). SYBR Green ER qPCR Super Mix
Universal and SYBR Green II were provided by Life Technologies (Shanghai, China). All other
reagents were of analytical reagent grade. All solutions were prepared using Milli-Q purified water.
1/7
Ligation of single-stranded DNAs
The circular single-stranded DNAs used as circle markers were prepared by the following operations.
The sequences are listed in Table S1. The ligation by T4 DNA ligase was performed in 20 μL volume
containing 1× ligation buffer (40 mM Tris-HCl, 10 mM MgCl2, 10 mM DTT and 5 mM ATP, pH 7.8),
0.5 μM DNA and 0.5 μM corresponding splint. The mixture was kept at 65°C for 7 min followed by
37°C, 10 min. Then 5 U of T4 DNA ligase was added to the mixture. The mixture was incubated at
25°C for 2 h. At the end of ligation, the mixture was incubated at 65°C for 10 min to deactivate the
DNA ligase. Then 20 U exonuclease I was introduced to the mixture to remove the linear (not
circularized) single-stranded DNAs.
Table S1 Sequence of oligomers used in preparing circular DNA markers a
Sequence (5' →3' )
Name
C72
C66
C60
Splint-C72
p-TTCAGCTTTTTTTTTTGCATCGTTCATCCAGTCCTTAGCAACCATTAATTTTTT
TTTTTTTTTTTTCTGGAA
p-TCAGTGTTTTTTTCGTCGATTGCAGTAACTCCCCACAACCTCTTTTTCGATGC
TTTTTTTGTGCGA
p-GGCACTTTTATTTTATTTTCAAAAGAAACCGTGCATCCACCATTTCGACGTTT
TCTAGCC
GCTGAATTCCAG
Length
72 nt
66 nt
60 nt
12 nt
Splint-C66
CACTGATCGCAC
12 nt
Splint-C60
AGTGCCGGCTAG
12 nt
a
“p-“ indicates a phosphate.
Site-specific cleavage of DNA-RNA chimeric oligomer
To confirm the site-specific cleavage by RNase H in the presence of Aid-DNA, a DNA-RNA chimeric
oligomer was used as the substrate. The RNA portion of the oligomer was complementary to the
Aid-DNA-16-1. And the heteroduplex is the substrate of RNase H. The FITC-labeled DNA-RNA
oligomer (10 μM) was incorporated in 9 μL 1× RNase H buffer containing 20 mM Tris-HCl (pH 7.8),
40 mM KCl, 8 mM MgCl2 and 1 mM DTT and 0.1 μM Aid-DNA-16-1. The reaction mixture was
heated to 65°C for 7 min and slowly cooled down to room temperature. Then 0.5 μL RNase H (5 U/μL)
was added and the mixture was incubated at 37°C for 40 min followed by inactivation of the RNase H
at 65°C for 10 min. The products were analyzed on a 20% denaturing urea PAGE.
Table S2 Sequence of oligomers used in cleavage of chimeric oligomer a
Name
a
Sequence (5' →3' )
Length
Aid-DNA-16-1
GCTGCUACGCCA
12 nt
F24
FITC-GCACGTCGACGTUGGCGUAGCAGC
24 nt
F17
FITC-GCACGTCGACGTUGGCG
17 nt
F18
FITC-GCACGTCGACGTUGGCGU
18 nt
F16
FITC-GCACGTCGACGTUGGC
16 nt
“p-“ indicates a phosphate. ‘FITC-’ denotes fluorescein-4-isothiocyanate modification.
2/7
2. Purification of RCT-SSD synthesized RNA oligomer
HPLC separation and purification
A 230II type of HPLC system (Elite, China) and YMC C18 column (250×4.6 mm, 5 mm; YMC, Japan)
were used for purification and separation. The following HPLC conditions were used to separate
desired RNA oligomers from the Aid-DNA: a linear gradient from 10 to 12% (20 min) acetonitrile
aqueous solution containing 50 mM ammonium formate; a flow rate of 1.0 mL/min; detection at 260
nm; 10 L of loaded reaction solution. The individual peak designated as mir-16 oligomer was
collected for further drying. The same HPLC condition was used to analyze standard mir-16 and
Aid-DNA-16-1 samples.
Vacuum freeze drying to obtain desired RNA oligomer in purity
A vacuum freezing-drying device (Sciencetool, Taiwan) was used for vacuum refrigerated centrifuge.
Liquid samples were subjected to a quick freeze by using liquid nitrogen. Then the samples were dried
for 4 h. After the vacuum freeze drying, the desired RNA oligomer appeared as a small amount of
white powder. Then 10 μL RNase free water was added to dissolve the RNA. For stem-loop RT-qPCR
quantification, the powder was dissolved in 20 μL RNase free water.
3. Stem-loop RT-qPCR for quantifying the synthesized RNA oligomers
Materials: All oligonucleotides used in stem-loop RT-qPCR were synthesized and purified by Sangon
Biological Engineering Technology (Shanghai, China). The chemical synthesized mir-16 RNA
oligomer was purchased from Integrated DNA Technologies (Coralville, USA) and used as the
standard. Their sequences were listed in Table S3. Deoxyribonucleotides (dNTPs) and RNase free
water were purchased from Thermo Scientific (Beijing, China). M-MulV reverse transcriptase was
provided by New England Biolabs (Beijing, China). SYBR Green ER qPCR Super Mix Universal was
provided by Life Technologies (Shanghai, China). All other reagents are of analytical reagent grade.
All aqueous solutions were prepared using Milli-Q purified water.
Table S3 Sequence of oligomers used in stem-loop RT-qPCR a
Sequence (5' →3' )
Name
Stem-loop primer
a
Length (nt)
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGCCAA
50
Forward primer
CGCGCTAGCAGCACGTAAT
19
Reverse primer
GTGCAGGGTCCGAGGT
16
mir-16
p-UAGCAGCACGUAAAUAUUGGCG
22
“p-“ indicates a phosphate modification.
3/7
Reverse transcription
The RNA oligomers are subjected to gradient dilution to suitable concentrations for RT-qPCR. Aliquot
of 10 μL solution was introduced in to a 20 μL of reverse transcriptase reaction solution containing
RNA samples including 50 nM stem-loop primer, 1×M-MulV buffer [50 mM Tris-HCl (pH 8.3), 75
mM KCl, 3 mM MgCl2, 10 mM DTT], 0.25 mM each of dNTPs, 2.5 U/μL M-MulV reverse
transcriptase and 1 U/μL RNase inhibitor. The solution were then incubated for 30 min at 16°C, 30 min
at 42°C, 5 min at 85°C and then cooled down and was used as the template for further RT-PCR.
Real time PCR
Real-time PCR was performed on illumine Eco Real-Time PCR system._ENREF_1 Aliquot of 2 μL of
above reverse-transcription solution was added to a solution (20 μL in total) containing 10 μL qPCR
Super Mix (2×), 1 μM forward/reverse primer. The reactions were incubated at 95°C for 10 min,
followed by 30 cycles of 95°C for 15 s and 68°C for 1 min.
4/7
Supplementary results
1. Quantification of microRNA products in Figure 4b by Bio-rad gel imaging system.
Figure S1 Quantification of microRNA products using a Bio-Rad gel imaging system.
Quantification results were obtained from imaging analysis of the bands in Figure 3b. Relative
quantification mode was select and sample S was used as the reference. Lane S was loaded with 1.0 μL
chemical synthesized mir-16 oligomer (100 μM) with 5′ phosphate modification. The amount of the
mir-16 oligomer was 100 pmole.
5/7
2. Quantification of microRNA products by RT-qPCR.
Reverse transcription qPCR is a powerful tool to quantify microRNA. Here, stem-loop RT-qPCR was
employed to assess the amount of the mircoRNA prepared by RCT-SSD synthesis.
mir-16 product was diluted by 10
10
1
The purified
folds and quantified by stem-loop RT-qPCR. The results were
shown in Fig. S1. The diluted RNA oligomer of our sample (green plot) was quantified as 1.5×103.59,
5.8×103 copies. Considering only 1/10 reverse transcription product was used and the sample was
diluted by 1010 folds, the purified RNA oligomer was of 5.8×10 14 copies equating 0.96 nmole (6.8 μg)
in 10 μL reaction volume. Since only 1/8 transcription products was used to be quantified, the total
amount of RNA oligomer should be 7.7 nmole equating 55 μg from the circle DNA template (10 nM in
ligation reaction).
A
B
y = -3.477x + 33.901
R² = 0.9993
Figure S2 Quantification of microRNA by RT-qPCR. (A) Real time amplification plots of mir-16.
Blue amplification plots represent mir-16 with known concentrations. The dynamic range of the
mircorRNA quantification plot was calibrated using chemical synthetic mir-16. The chemical synthetic
RNA was quantified based on A260 value and diluted over five orders of magnitude. The green one
denotes the microRNA sample with unknown concentration. (B) Standard curve was obtained from Cq
value of mir-16 with known concentration. The Cq value of the unknown mir-16 sample was selected
from the chart. By referring to the linear equation, the Cq value of the unknown mir-16 was 21.41,
representing 1.5×103.59 copies of mir-16 in the diluted sample.
6/7
3. Designing of cDNA-Ribo used as the template for transcription of ribozyme
Figure S3 Illustration of the design of cDNA-Ribo for circularization. The cDNA-Ribo sequence
used as the template to transcribe HHR is originated from cDNA of the HHR with adjustment. The 5’
end portion (red) of HHR cDNA is moved to the 3′ end and the new 5′ end is started with “TTT”
(green). The splint-Ribo is designed complementary to both ends of cDNA-Ribo, which is circularized
and serves as the template for transcription of HHR.
REFFERENCE
1 Chen, C, Ridzon, DA, Broomer, AJ, Zhou, Z, Lee, DH, Nguyen, JT, et al. (2005). Real-time
quantification of microRNAs by stem–loop RT–PCR. Nucleic Acids Res 33: e179.
7/7