Supporting Figure 1: Wild-type and MIF-/- mice have similar blood ethanol
concentrations. C57BL/6 and MIF-/- mice were allowed free access to ethanol
containing diets or pair-fed control diets, or given an oral gavage of 25% ethanol
diluted in 0.9% saline. Blood ethanol was measured after (A) 90 minute oral
gavage or (B) 23 days, 32% ethanol feeding. Values represent means ± SEM,
n=4 pair-fed and n=4 ethanol-fed (A) and n =7 wild-type and n=3 MIF-/- (B).
Supporting Figure 2: MIF expression is decreased in liver of CYP2E1-/- mice.
129/Sv-C57BL/6N and CYP2E1-/- mice were allowed free access to an ethanolcontaining liquid diet or pair-fed control diets. (A) Expression of MIF mRNA was
measured in liver by qRT-PCR after 25d, 32% ethanol feeding. Expression of the
genes of interest was normalized to 18S (n=4 pair-fed and n=6 for ethanol-fed
mice). Values represent means ± SEM. Values with different superscripts are
significantly different from each other (P < 0.05).
Supporting Figure 3: Quantification of C3b, TUNEL and F4/80 IHC after 4d,
11% ethanol feeding. C57BL/6 and MIF-/- mice were allowed free access to an
ethanol-containing liquid diet or pair-fed control diets. Immunoreactive (A)
TUNEL positive nuclei, (B) C3b/iC3b/C3c, (C) TNFα and (D) F4/80 were semiquantified in wild-type and MIF-/- mice after 4d, 11% ethanol feeding. (E) TUNEL
positive nuclei co-localized with F4/80+ cells in liver of wild-type mice after 4
days, 11% ethanol feeding. White box insets represent nuclear TUNEL staining
of sinusoidal Kupffer cells. Values represent means ± SEM. Values with different
superscripts are significantly different from each other (P < 0.05).
Supporting Figure 4: Neutrophil trafficking to the liver involves MIF-independent
processes. C57BL/6 and MIF-/- mice were allowed free access to ethanol
containing diets or pair-fed control diets. After 25d, 32% ethanol feeding, mice
were challenged with LPS via intraperitoneal injection 4hr prior to euthanasia. (A)
Neutrophil infiltration was examined by immunoreactive NIMP14 in liver of pairand 25d, 32% ethanol-fed wild-type and MIF-/- mice. (B) Black arrows indicate
positive NIMP14 staining, suggesting the presence of neutrophils after 4hr LPS
challenge. Inset represent zoom of positive NIMP14 staining in liver of 25d, 32%
ethanol-fed mice. Images were acquired using 20x objective. Figures represent 2
images per liver and 4 mice per experimental condition. Values represent means
± SEM, n= 4 pair-fed and n=6 ethanol-fed.
Supporting Materials:
Ethanol feeding. Ethanol-fed animals were allowed free access to LieberDeCarli (Catalog # 710260, Dyets Inc, Bethlehem, PA) ethanol-containing diet
after 2 days of being acclimated to the liquid diet. Animals were fed 5.5% (total
kcal) ethanol for 2 days, 11% for 2 days (4d), 22% for 1 week (11d), 27% for 1
week (18d), and finally 32% for 1 week (25d). Control mice were pair-fed an
identical liquid diet except the diet is iso-calorically substituted with maltose
dextrans in place of ethanol. In some experiments, animals were treated with
0.7μg/g body weight of lipopolysaccharide (LPS, lot # 120M4028; strain E. coli
026:B6, Sigma Aldrich, St. Louis, MO) or saline via intraperitoneal injection 4hrs
prior to euthanasia. Mice were euthanized at day 4 (4d, 11%) or day 25 (25d,
32%).
Blood Ethanol Quantification. Blood was collected into heparinized
microcapillary tubes from pair- and ethanol-fed mice via tail vein after 23 days,
32% ethanol feeding. Plasma ethanol concentration was quantified using Ethanol
L3K kit (Sekisui Diagnostics, Framingham, MA) according to manufacturer’s
recommendations. For gavage experiments, wild-type and MIF-/- mice were
fasted 16-18 hours, and then given an oral gavage of 25% ethanol diluted in
0.9% saline. Blood was collected via tail vein and ethanol was quantified as
described above.
Plasma ALT/AST measurements and liver triglycerides. Plasma samples
were analyzed for alanine aminotransferase (ALT) and aspartate
aminotransferase (AST) via enzymatic assay (Sekisui Diagnostics, Framingham,
MA) following the manufacturer’s instructions. Flash frozen liver samples were
used to quantify triglyceride accumulation using the Triglyceride Reagent Kit
(Pointe Scientific Inc., Lincoln Park, MI).
Quantitative Real-Time PCR primer sequences.
Primer
MIF
Forward Sequence
GCCAGAGGGGTTTCTGTCG
Reverse Sequence
GTTCGTGCCGCTAAAAGTCA
CD74
F4/80
TLR4
TNFα
MCP-1
CXCL10
MIP2
CD11b
ICAM-1
CD62E
GAACCTGCAACTGGAGAGCC
CCCCAGTGTCCTTACAGAGTG
ATGGCATGGCTTACACCACC
CCCTCACACTCAGATCATCTTCT
AGGTCCCTGTCATGCTTCTG
CCAAGTGCTGCCGTCATTTTC
GCGCCCAGACAGAAGTCATAG
ATGGACGCTGATGGCAATACC
GTGATGCTCAGGTATCCATCCA
ATGAAGCCAGTGCATACTGTC
GGTTTGGCAGATTTCGGAAG
GTGCCCAGAGTGGATGTCT
GTTCTCCTCAGGTCCAAGTTGCCGTTTC
GCTACGACGTGGGCTACAG
TCTGGACCCATTCCTTCTTG
GGCTCGCAGGGATGATTTCAA
AGCCTTGCCTTTGTTCAGTATC
TCCCCATTCACGTCTCCCA
CACAGTTCTCAAAGCACAGCG
CGGTGAATGTTTCAGATTGGAGT
Immunohistochemistry antibody sources.
Antibody
MIF
F4/80
C3b/iC3b/C3c
Ly6C
4hydroxynonenol
Source
Life Technologies, Grand Island, NY
clone BM8, eBioscience Inc., San Diego, CA
clone 2/11, Hycult Biotechnology, Uden, Netherlands
clone ER-MP20, AbD Serotec, Raliegh, NC
4HNE; Alpha Diagnostics Intl Inc., San Antonio, TX
NPC Isolation, Western blot and Flow Cytometry. Livers were digested in
RPMI with Type IV Collagenase (Sigma Aldrich, St. Louis, Missouri, Lot#
087K8630) and DNase I (Roche, Mannheim, German) for 45min at 37° C.
Digested clumps of liver were pressed through a 70um strainer and washed with
RPMI with 10% FBS. Cells were centrifuged at 50g for 10min; supernatant was
then centrifuged at 50g for 7min. To pellet the NPC fraction, cells were
centrifuged at 300g for 7min. Cells were resuspended in BD Pharm Lyse (BD
Biosciences, San Jose, California) for 5min on ice. Cells were washed with
RPMI with 10% FBS and centrifuged at 300g for 10min. (Gibbons MA, American
Journal of Respiratory and Critical Care Medicine, 184, 2011). Samples were
denatured in Laemmli buffer for Western blot analysis and then stored at −20 °C.
NPC protein lysates were loaded onto 4% - 12% reducing SDS-polyacrylamide
gradient gels. MIF antibody (Torrey Pines Biolabs, Inc, Secaucus, NJ) was used
at 1:500 and CD74 (Santa Cruz Biotechnology, Santa Cruz, CA) was used at
1:1000 in 1% Bovine Serum Albumin to detect immunoreactive protein using
enhanced chemiluminescence, images were collected, and signal intensities
were quantified using Eastman Kodak Co. Image Station 4000R.
For flow cytometry, cells were resuspended in FACS buffer (1x PBS, 1% BSA,
0.05% sodium azide). Cells were aliquoted into 96 well plates at a concentration
of ~1x106 cells/mL. Cells were centrifuged at 830 x g for 4 minutes, resuspended
in 50ul FACS buffer containing 0.5ug of Fcγ Block (clone 93, eBioscience, San
Diego, California), and incubated for 15 minutes at room temperature. After
blocking, cells were stained with fluorochrome-conjugated antibodies CD206,
Ly6c (clone MR5D3 and ER-Mp20, respectively, AbD Serotec, Raliegh, North
Carolina), F4/80, CD86, CD11b (clone BM8, GL1, M1/70, respectively,
eBioscience, San Diego, California), CD11c (clone HL3, BD Biosciences, San
Jose, California) for 30 minutes at 4° C in the dark. Cells were washed and
centrifuged at 830 x g for 4 minutes twice with FACS buffer. Stained cells are
resuspended in 200ul of 1% paraformaldehyde and kept in the dark at 4° C
overnight. Stained cells were centrifuged at 830 x g for 5 minutes. Stained cells
were resuspended in 300ul of FACS buffer, and data was collected on a LSRII
flow cytometer (Becton Dickinson Immunocytometry systems, Mountain View,
CA). Data collected on the LSRII were analyzed using FlowJo software (Tree
Star, Inc., Ashland Oregon). To calculate the total number of CD45+ NPCs per
liver, the total number of isolated NPCs was multiplied by the percentage of
CD45+ cells in each liver. To obtain the total number of CD11c+ and Ly6C+ cells,
the total number of CD45+ cells was multiplied by the percentages of CD11c+ and
Ly6C+ cells. See Supporting Materials for additional details.