Electronic supplementary material 2. Supplemental Material and Methods.
(a) Microarrays
We generated cDNA microarrays representing 99 genes expressed during Heliconius
wing development. 81 cDNAs were ESTs randomly sequenced from a cDNA library
representing a mix of fifth instar and pupal wings from multiple regional phenotypes. 18
cDNAs on the microarray represented developmental candidate genes cloned using
degenerate PCR. DNA was PCR amplified and spotted on glass Corning slides using a
Virtek Chipwriter Pro. Each array was composed of four identical subarrays, each with
double spotted cDNAs. This provided a total of eight within-chip replicates for each
cDNA. GenBank accession numbers are provided in the electronic supplementary
material.
H. erato and H. himera were reared on Passiflora biflora in insectaries in Puerto
Rico. Pupal wings and larval imaginal discs were dissected in phosphate buffered saline
(pH = 6.8). Wing tissue was either immediately transferred to cold Trizol (Invitrogren)
for immediate RNA extraction, or stored in RNAlater (Ambion Inc.) at –20ºC prior to
RNA extraction. Tissue was homogenized and total RNA was extracted with Trizol and
purified with RNeasy columns (Qiagen). Total RNA was analyzed with an agarose gel to
verify absence of degradation products.
For each microarray replicate, forewings were removed from three late stage H.
erato petiverana pupae. Wings were dissected into three regions representing major color
pattern elements, and the tissue samples were grouped into three respective pools from
which total RNA was extracted. Reverse transcription aminoallyl labeling reactions were
performed with 20g of total RNA. The resulting cDNA was column purified and
coupled to either Cy3 or Cy5 dye. Labeled cDNA was run on a gel and fluorescently
visualized to verify the quality of the labeling reactions. Microarray hybridizations were
performed overnight at 52°C with an Automated Hybridization Station (Genomic
Solutions), and slides were visualized on an arrayWoRx Biochip Reader (Applied
Precision Inc.).
We conducted two comparisons using pooled RNA extracted from pupal wings at
a stage approximately one day before eclosion. At this time point the scales have matured
and red and black pigments have appeared. The first comparison was between RNA
extracted from the proximal melanic region of the wing and the red band, and the second
comparison was between the red band and the distal melanic region of the wing. This
strategy was taken because the proximal tissue produced about twice the amount of total
RNA as the band or distal tissue. This difference in total RNA yield was likely due to the
fact that the dissected proximal tissue samples were physically larger than the dissected
band or distal-tip tissue samples. Each comparison was replicated twice with swapped
dyes.
Prior to data analysis, abnormal spots (i.e. smeared, scratched, or otherwise
obscured) were identified and removed from the dataset. Cy3 and Cy5 spot intensities
were normalized using local background and recorded into a spreadsheet. Data from dyeswapped replicate experiments were imported into the GeneSpring program (Agilent
Technologies) for analysis. Expression ratios for each gene were calculated using an
average of the median-normalized intensities. t-tests were implemented in GeneSpring to
determine the significance of gene expression differences between tissue types.
(b) Quantitative Real-time PCR
Total RNA was extracted from identical wing pattern elements from both right and left
wings of a single individual and was treated with the DNA-free kit (Ambion, Inc.), after
which cDNA was synthesized using the TaqMan reverse transcription kit (Applied
Biosystems, Inc.) with polyT primers. The following gene-specific primers were used for
SYBR Green (Applied Biosystems, Inc.) qPCR reactions carried out in an ABI Prism
7000 Sequence Detection Systems: annexin IX Fwd 5'CGGTAACTTGGAGAACGTGATCGT, annexin IX Rev 5'TCTTCATCAGTGCCCAATCCTGAC, vermilion Fwd 5'CCTGGAAACAATGACACCACTGGA, vermilion Rev 5'ATTGCAAGCTTTGGAAGCCAGACG, cinnabar Fwd 5'CCGGCTTCGAGGACTGTTATCTAT, cinnabar Rev 5'CACTGATCGCAAATGCATCTCTCC. A standard dissociation protocol was used with
a melting temperature of 60ºC. Relative transcription levels were calculated using a
standard curve from a cDNA pool standard dilution series. Individual cinnabar and
vermilion and data were normalized using expression levels of an annexin IX control.
Three replicates were executed for each tissue type and time point. Each replicate was
normalized separately. Data are presented as mean values with standard deviations.
(c) 3-OHK spectrophotometry, radiolabeling, and incorporation
Pure 3-OHK was diluted in methanol, its 200-600nm absorbance spectrum was
determined using a spectrophotometer, and a dilution series standard curve was
calculated for the 380nm absorbance peak (not shown). Hemolymph from late-stage H.
himera pupae was extracted, diluted in at least an equal volume of cold methanol,
centrifuged for 10min at 13k RPM, and stored at -20ºC. Samples were then further
diluted in methanol and 200-600nm absorbance spectra were determined. Hemolymph 3OHK concentrations were then determined based on the 380nm absorbance peaks. To
assay for the presence of 3-OHK in H. himera fat bodies, complete fat bodies were
removed and placed in 500 L of acidified methanol (1% HCl). Instead of homogenizing
the fat bodies, they were leeched in the acidified methanol for ~6 months at -20ºC, and
samples of the methanol were then analyzed on a spectrophotometer.
C-labeled 3-OHK was generated by injecting 0.1 Ci of 14C-trytophan (the 3-
14
OHK precursor), diluted in 2 mL insect saline (pH=6.9), into the hemolymph of latestage H. himera pupae and allowing the adults to emerge. Four yellow forewing bands
were cut from the dried forewings of the previously injected adults and pooled, sonicated,
and homogenized in 500 L of acidified methanol (1% HCl). The resulting slurry was
centrifuged at 14k rpm for 5 min, and the yellow supernatant was dried down in a
vacuum centrifuge for 30 min, leaving approximately 50 L. This solution was spotted
onto a silica gel 60 F254 thin layer chromatography plate (Merck), along with a pure 3OHK control. The chromatography plate was then run in a 3:1 phenol:water developing
solvent. The wing extraction produced a bright yellow, UV-fluorescing band at Rf=0.56,
which was identical to the band produced by the 3-OHK control. The silica scrapings
from this band were placed in 500 L of methanol, vortexed, and then centrifuged at 14k
rpm for 5 min. The yellow supernatant was removed and dried down in a vacuum
centrifuge. The resulting pellet was resuspended in 50 l of Ringer’s Solution and its
radioactivity was assayed with a scintillation counter.
1.5 nCi of 14C-3-OHK was injected in late stage H. himera pupae that were then
frozen 1 d after injection. Pupal wings were dissected out of the frozen pupae, allowed to
dry, and then mounted, dorsal surface up, on paper using plastic food wrap. Mounted
pupal wings were exposed to HyBlot CL autoradiography film (Denville Scientific,
Metuchen, NJ) for 36 d at -20ºC.