Materials and Methods
Samples.
Normal and pathological placenta samples (Pathology Department Tissue Bank,
Hôpital Edouard Herriot, Lyon, France) were fixed in formalin, paraffin-embedded,
sliced into 4-m sections, and stained with hemalun-eosin. For molar tissues, after
review of the slides by Dr. L. Frappart, lesions were classified according to the WHO
classification, and karyotypes were determined.
Spermatozoa were purified from semen samples by Percoll gradient centrifugation.
The purity of the preparation was controlled by microscopy.
Metaphase II oocytes that failed to fertilize 24 hours after conventional IVF were
collected from the IVF laboratory (Laboratory of Reproduction Biology, Hôpital E.
Herriot, Lyon, France). Follicular cells linked to the zonae pellucidae were removed
by pipetting and enzymatic methods. Oocytes were rinsed several times in PBS and
stored in liquid nitrogen until use. Supernumerary human diploid zygotes obtained
after in vitro fertilization, which were considered unsuitable for transfer and could not
be frozen, were collected with the corresponding consent (HEH, Assisted Conception
Unit), and selected samples were purified by enzymatic digestion as described for
oocytes. All purification steps were performed under microscopy. Human triploid
zygotes obtained 16 hours after in vitro fertilization were staged, and selected
samples were purified by enzymatic digestion as described for oocytes. In humans
oogenesis (and in most vertebrates), the first polar body does not progress to meiosis
II, but the secondary oocyte does proceed as far as the metaphase of meiosis II then
stops. Only if fertilization occurs will meiosis II ever be completed, the secondary
oocyte be converted into a zygote, and a second polar body be formed. Therefore, in
triploid eggs, the presence of two polar bodies indicates dispermic fertilization.
Control experiments using a region of the BRCA1 CpG island that is specifically
unmethylated in germ cells indicated an absence of somatic cells in oocytes or
zygote samples after these treatments. Both germ cells and embryos were obtained
once parental consent had been obtained. The research program was approved by
the Commission Nationale de Médecine et Biologie de la Reproduction (Ministère de
l'Emploi et de la Solidarité).
Immunohistochemistry.
Paraffin blocks containing representative tissues samples were selected for each
case, and 4-µm thick sections were obtained and mounted on silanized glass slides.
The immunostaining procedure was carried out as previously described.
DNA extraction.
DNA was extracted from 10-m sections of paraffin blocks containing fixed tissue
and frozen spermatozoa using standard procedures (Kit QiaAmp DNA Mini Kit,
Qiagen, Courtaboeuf, France). Oocyte and zygote samples were incubated at 80°C
for 5 minutes in the presence of 4 g of carrier DNA (pGL3-basic plasmid, Promega,
Lyon, France) and lysed in a final volume of 100 l of 50 mM Tris-50 mM EDTA
buffer containing 0.25% SDS and 20 g/ml of proteinase K (Roche, Mannheim,
Germany). The mixture was incubated at 55°C for 2 hours, after which the samples
were processed as described in the" bisulfite modification" section below.
Global 5-methylcytosine quantification.
The 5-methylcytosine (mC) content was determined by high-performance capillary. In
brief, DNA samples were pre-concentrated to 0.1 g/l using a SpeedVac
concentrator then enzymatically hydrolyzed in a final volume of 5 l. Samples were
then directly injected in a Beckman MDQ high-performance capillary electrophoresis
apparatus and the mC content was determined as the percentage of mC in the total
cytosine: mC peak area x 100 / (C peak area + mC peak area).
Bisulfite modification.
Sodium bisulfite modification followed by sequencing of PCR products was used to
determine the CpG methylation pattern. Sodium bisulfite converts unmethylated
cytosines to uracils, while methylated cytosines remain unmodified. In the resultant
modified DNA, uracils are replicated as thymines during PCR amplification. The
sodium bisulfite reaction was carried out on 3 g of carrier (pGL3-basic plasmid,
Promega, Lyon, France). Alkali-denatured DNA was incubated for 16 hours at 50°C
in 3 M NaHSO3 and 5 mM hydroquinone in a final volume of 500 l. Modified DNA
was purified using the Wizard DNA Clean-up System (Promega, Lyon, France) and
eluted in 50 l of sterile water. Modification was completed with 0.3 M NaOH and
DNA was purified using a column system (Mini-Elute PCR purification kit, Qiagen,
Courtaboeuf, France). DNA fragments were amplified from pooled samples (8 to 13
oocytes or zygotes per essay) by a nested PCR for single-copy genes and a onestep PCR for repetitive elements. Two coding sequences (a segment from exon 11 of
BRCA1 and the exon 4 of p53) were analyzed as described previously by one-step
PCR (Magdinier, et al.,2000). Four types of repetitive elements were amplified. NBL2
and Sat2 were amplified using primers and under conditions previously described
(Mund, et al., 2005; Fraga, et al., 2005) LINE-1 elements were amplified using
primers designed to amplify a 374-bp sequence at their 5’ end (positions 337 to 711)
of LINE-1 elements (Gen-BankTM accession number X58075). AluY was amplified
using primers designed to amplify a 260-bp sequence from positions 22 to 282 in the
286-bp AluY sequence. PCR amplification was performed in a 100-l volume using
the HotStart Taq polymerase kit (Qiagen, Courtaboeuf, France), with 2 mM MgCl2,
100 µM of each of the four deoxyribonucleoside triphosphates (Roche Applied
Science, Meylan, France), 0.25 M of the primers and 1.25 units of HotStartTaq DNA
polymerase, after 40 cycles in a thermocycler (30 s denaturation at 94°C, 1 min
annealing at 55°C and 1.5 min extension at 72°C). PCR products were first analyzed
by digestion with restriction enzymes, then cloned into a TOPO-TA vector (Invitrogen,
Cergy Pontoise, France). Random clones were then analyzed by automatic
sequencing (Biofidal, Lyon, France) to determine the proportion of methylated (CpG)
and unmethylated (TpG) sites. A few clones with identical sequences were rejected
on the grounds of their possible monoclonal origin. The following primers were used
for the PCR amplifications:
Human LINE-1, Forward: 5' ATTTTATATTTGGTTTAG AGGG 3', Reverse: 5'
ATCAAAAATCAAAAACCCACTT 3;
Human AluY, Forward: 5' TTTGTAATTTTAGTACTTTGGGAGGT 3', Reverse: 5'
TTTAAAACRAAATCTCRCTCTATCRCCCAAAC 3;
Human NBL2, Forward: 5' GTAGTTGGTGTTAATGTGTGTTAT 3', Reverse: 5'
CACTCTCTATATATTTCTTTCCC 3';
Human satellite 2, Forward: 5' ATGGAATTTTTATGAAATTGAAATG 3', Reverse: 5'
CATTCCATTAAATAATTCCATTC 3'.
Immunofluorescence staining.
Human triploid and diploid zygotes were washed in PBS and the zonae pellucidae,
were removed by enzymatic digestion with hyaluronidase at 37°C (type VIII
hyaluronidase, Sigma, L'Isle d'Abeau, France). Zygotes were rinsed in PBS and
immediately fixed in 4% paraformaldehyde in PBS for 15 min. After PBS washing,
zygotes were permeabilized with 1% triton X-100/PBS for 15 min. For the detection of
histones, cells were immediately blocked with 1% BSA and incubated with specific
antibodies, polyclonal anti-acetyl-Histone H3 (Lys9, 14), anti-acetyl-Histone H4 (Lys4,
7, 11, 15), anti-dimethyl-Histone H3 (Lys4) and anti-trimethyl-Histone H3 (Lys9)
(Upstate Biotechnology, Lake Placid, NY), at appropriate dilutions in “Antibody
Diluent” (DAKO Corporation, Carpinteria, CA). For labeling with anti-5-methylcytosine
antibody (a generous gift from Dr. A. Niveleau), permeabilized cells were treated with
HCl 2N for 30 min. The preparation was then neutralized with 100 mM Tris/HCl
buffer, pH 8 for 10 min. After extensive washing in 0.05% Tween-20/PBS, the primary
antibody against 5-methylcytosine was detected by Alexa Fluor 594 goat anti-mouse
IgG (H+L) (Molecular Probes, Interchim, France). DNA was stained by 3 µg/ml 4’,6diamidino-2-phenylindole (DAPI, Molecular Probes, Interchim, France), then zygotes
were washed in PBS and mounted in Fluorescent Mounting Medium (DAKO
Corporation, Carpinteria, CA). Slides were observed with a Leica (DMRB)
epifluorescence microscope (using separate filter sets). Images were recorded using
a Nikon digital camera (DXM1200), analyzed with Lucia software (Laboratory
Imaging 4.6 software, Nikon, Paris, France) and merged with Adobe Photoshop 7.0
software.
Anti-5-methylcytosine Chromatin Immunoprecipitation.
HeLa cells were washed and scraped off culture dishes in PBS, then lyzed in a
hypotonic buffer containing 0.1% Nonidet P-40. After centrifugation and washing,
nuclei were treated with HCl 1N for 5min and pH was neutralized, for 5 min, with 1M
Tris/HCl buffer, pH 8. After centrifugation, the pellets were washed in hypotonic buffer
and resuspended in 1 ml of SDS lysis buffer (1% SDS, 10 mM EDTA, 50 mM TrisHCl pH 8). Nucleoproteins were sonicated to reduce DNA fragments to 300–600 bp
length. Debris were removed, and the supernatant was collected. Thirty microliters of
this fraction were preserved for use as an input control; the other part of the fraction
was diluted 1:3 in ChIP dilution buffer (ChIP assay Kit, Upstate Biotechnology, Lake
Placid, NY). The DNA solution was precleared one hour at 4°C by incubation with 80
µl of salmon sperm DNA-protein A-agarose beads (Upstate Biotechnology, Lake
Placid, NY). The soluble fraction was collected, and 50µl of monoclonal anti-5methylcytosine antibody was added and incubated over night at 4°C. Because anti-5methylcytosine is monoclonal, 1 µg of rabbit polyclonal anti-mouse antibody
(Dakocytomation, Trappes, France) was added. After immunoprecipitation, immune
complexes were collected by adding 60 µl of salmon sperm DNA-protein A-agarose
beads for one hour at 4°C. A 500 µl sample of the supernatant corresponding to the
unbound fraction was collected. After washing, complexes were eluted from the
beads in 1% SDS, 0.1 M NaHCO3. This last fraction corresponds to the bound (anti5MeCyt) fraction. DNA was recovered by proteinase K digestion, phenol extraction,
and ethanol precipitation. Finally, DNA samples, from input, unbound and bound
fractions were quantified by densitometry using Flour’s fluorimeter and Quantity One
software (Bio-Rad, Ivry, France) in comparison with serial dilutions of a standard
DNA.
Semi-quantitative PCR amplification was performed. We amplified equal amounts of
total DNA samples (0.5 ng) from input, unbound and bound fractions. We analyzed
two types of sequences: repetitive elements (AluY and LINE-1) and fragments of
single copy genes (fragments of the BRCA1 CpG Island and exon 1). LINE-1 was
amplified using: forward 5'-GAG TTC CCT TTC CGA GTC AA-3’, and reverse 5’GCC AGG TGT GGG ATA TAG TC-3’ primers designed to amplify a 130 bp
sequence from positions 220 to 350 in promoter LINE-1 (Gen-BankTM
accession number X58075). AluY was amplified using: forward 5'-CGA GGC GGG
CGG ATC ACG AGG T-3’, and reverse 5’- AGT CTC GCT CTG TCG CCC AGG C-3’
primers designed to amplify a 225 bp sequence from positions 47 to 272 in 286 bp
AluY sequence. We also amplified a region of the BRCA1 CpG island from positions 1364 to -1218 of the BRCA1 transcription start site, using: forward 5’-AAG GGC TCC
TCC AGC ACG GC-3’, and reverse 5’-TTC TGA GGG ACC GAG TGG GC-3’
primers; and a fragment of BRCA1 exon1 from positions -56 to 263 of the BRCA1
transcription start site, using: forward 5’-TAG CCC TTG GTT TCC GTG-3’, and
reverse 5’-TCA CAA CGC CTT ACG CCT C-3’ primers. PCR was accomplished in a
final volume of 100 µl using the HotStarTaq polymerase kit (Qiagen, Courtaboeuf,
France) and 0.25 µM of AluY and LINE-1 primers or 0.4 µM of BRCA1 CpG Island
and BRCA1 exon1 primers. The PCR amplification was performed after15 min Taq
polymerase activation at 95°C and 21 cycles (AluY), 26 cycles (LINE-1), 37 cycles
(BRCA1 CpG island) or 36 cycles (BRCA1 exon 1) in a thermocycler under the
following conditions: 30 sec denaturation at 94°C; 1 min annealing at 68°C (AluY),
60°C (LINE-1), 64°C (BRCA1 CpG island) or 60°C (BRCA1 exon 1); and 1.5 min
extension at 72°C.