Isolation and characterization of MSCs
Clinical-grade MSCs were generated under good manufacturing practice conditions.
Human bone marrow samples donated from healthy donors were used to isolate and
expand MSCs after informed consent.
Human MSCs were isolated and cultured as previously described1-3. In brief, 20-30ml
bone marrow was diluted 1:1 with human MSC growth medium (consisting of low
glucose Dulbecco’s modified Eagle’s medium (L-DMEM; Hyclone, Logan, UT, USA)
and 10% fetal bovine serum (FBS; Hyclone)). Marrow mononuclear cells were
separated by Ficoll-Paque (1.077 g/mL; Amersham Biosciences, Uppsala, Sweden)
density gradient centrifugation and seeded at a density of 1x105/cm2 into T75 cell
culture flasks. When cells grew to 80% confluence, they were detached by
trypsin-EDTA designated as passage 1. These cells were further passaged at a ratio of
1:3.
The culture-expanded MSCs expressed CD29, CD44, CD73, CD90, CD105 and
CD166, but not CD34 or CD45. They could be induced to differentiate into cells of
osteogenic, adipogenic lineages under proper induction medium (Figure S1). All the
cells have shown a normal karyotype at passage 3 and 6, were clinically used at
passage 4 or 5. Cells at passage 4 or 5 were used in this study.
To examine the proliferation capacity of MSCs in vitro, the population doubling
time(PDT) was measured at passage 3 and 6. In brief, 2ml of cell suspension was
plated onto a 6-well plate at 2×10 4 cells/well and cultured for 7-10 days. Viable cells
(as determined by trypan blue exclusion) were counted by Cellometer Auto T4
automated cell counters (Nexcelom Bioscience, Lawrence, MA, USA). Cell counts
were performed at each passage and population doublings calculated using the
formula (t−t 0)∙log2/(logN−logN 0) , where t−t 0 is culture time (h), N is the number of
harvested cells and N 0 is the number of cells in the initial . The population doubling
time (PDT) of MSCs was 33.1±3.88 hrs at passage 3 and 36.7±5.07 hrs at passage 6
(Figure S2).
Criteria for release of mesenchymal stem cells for clinical use included: normal
karyotypes, absence of visible clumps, sterility - negative for bacteria and fungi, no
detectable mycoplasma and endotoxin, cell viability greater than 95%, cell purity- the
expression of CD29, CD44, CD73, CD90, CD105 and CD166 ( >90%) and the lack
of CD34 and CD45 (<5%).
Assessment of cGVHD patients
In 2005, the National Institutes of Health (NIH) developed a cGVHD score
which used a score of 0 to 3 from mild to severe, and this was validated in a
subsequent study4 .
In the present study, the NIH’s consensus criteria was also
used for cGVHD diagnosis, organ scoring, and global assessment of chronic
GVHD status before the MSCs treatment and each follow-up visit 5 . The
evaluations of seven organs (skin, mouth, eye, gastrointestinal [GI] tract, liver,
lung and joints) were carried out at least two clinicians independently.The
average score of seven organs (average NIH score) was calculated as evaluation
of the global severity of the disease. Objective assessment of cGVHD severity
including ocular and modified oral Schirmer tests, oral mucosal scoring 6 , the
NIH skin response scale according to percentage of body surface area (BSA)
involved with erythematous rash, movable sclerosis and non movable sclerosis 7,
pulmonary function tests, liver function tests and radiographic measurements.
Additionally,
all
recipients
were
required
to
complete
a
validated
self-administered symptom scale assessment 8.
The response to MSC treatment was defined as follows: CR was defined as the
resolution of all clinical manifestations and laboratory data of the involved
organs; PR was defined as improvement by at least one point in the involved
organ or more than 50% improvement of clinical laboratory data of the involved
organs without CR; minor partial response (mPR) was defined as improvement
less than one point in the involved organ or less than 50% but more than 25%
improvement of laboratory data; NR was defined as deterioration, no
improvement of clinical manifestations, or less than 25%
improvement of
laboratory data.
Proliferation assay
Isolated CD3+ T lymphocytes were stained using the CellTrace™ CFSE Cell
Proliferation kit (stain concentration of 5 μΜ; Invitrogen) according to the
manufacturer’s instructions. Sorted CD5+ B cells were cultured in replicate wells either
alone or in the presence of LPS (10 μg/ml) for 24 hours. Labeled CD3+ T cells were
cultured in triplicate in 96-well plates. The culture conditions included labeled CD3+ T
cells alone, labeled CD3+ T cells in the presence of isolated B cells (2:1 ratio), or
labeled CD3+ T cells in the presence of LPS-activated B cells (2:1 ratio). All T cells
were stimulated with an anti-CD3 mAb(0.2 μg/ml, BD Biosciences Pharmingen) and an
anti-CD28 mAb (1 μg/ml, BD Biosciences Pharmingen) for 96 hours. T cell
proliferation was evaluated by flow cytometric analysis of CFSE dilutions.
CD5+ B cells and CD5- B from healthy donors were isolated and stimulated by LPS
(10μg/ml, Sigma) in the absent or present of MSCs. Cells were stained with the
Click-iT® EdU Alexa Fluor® 647 Cell Proliferation Assay Kit (stain concentration of
10μΜ;Molecular Probes, Invitrogen) according to the manufacturer’s instructions.
After cultured for 96 hours, CD5+ B cells and CD5- B were analyzed by flow
cytometry.
Survival assay
CD5+CD19+ B cells and CD5-CD19+ B cells were separately isolated from healthy
donors and cGVHD patients using an Influx cell sorter. Sorted cells were divided into
two groups and were either cultured alone or co-cultured with MSCs at a 1:4 ratio in
24-well plates. After 96 hours of culture, the extent of B cell survival was measured by
the flow cytometric analysis of annexin V and propidium iodide (PI) staining (BD
Biosciences Pharmingen). The data were analyzed using FlowJo 7.6 software. Blocking
experiments were performed by culturing the cells with 10 μg/ml anti-IL-10 mAb
(R&D
Systems),
10
μg/ml
anti-IL-6
mAb
(R&D
Systems),
1
mM
1-methyl-DL-tryptophan (DL-1 MT, Sigma), 1 mM 1-methyl-D-tryptophan (D-1
MT, Sigma), 1 mM 1-methyl-L-tryptophan (L-1 MT, Sigma), or 1 μM NS398
(Sigma).
High-performance liquid chromatography (HPLC)
MSCs were cultured in L-DMEM without or with 2.5 ng/ml IFN-γ for 72h, IDO
enzyme activity of MSCs was measured by high-performance liquid chromatography
(HPLC; Alliance Separations Module 2690; Waters,Milford, MA). In addition, IDO
activity was quantified in CD5+ B cell/MSC and CD5- B cell/MSC coculture systems
by HPLC. Tryptophan was detected by fluorescence at 285-nm excitation and 365-nm
emission wavelengths, kynurenine was detected by UV absorption at 360 nm. Peak area
values for kynurenine and tryptophan were determined and the results for IDO activity
were shown as a kynurenine/tryptophan ratio.
Western blot
After cultured for 72h in different conditions (alone, with IFN-γ, with resting CD5+ B
cells,
with activated CD5+ B cells by LPS, with resting CD5- B cells or with
activated CD5- B cells by LPS), MSCs lysates were prepared and centrifuged at 4°C.
The proteins were separated by SDS-PAGE and transferred to PVDF membrane. After
blocking, the membrane was incubated with rabbit anti-IDO1 antibody (Cell
Signaling Technology), and then incubated at room temperature with secondary
antibodies.
Antigen–antibody
complexes
were
chemiluminescence (GE Healthcare Biosciences, USA).
detected
by
enhanced
Silencing of IDO1 in MSCs in vitro using IDO-siRNA
To
knockdown
IDO1,
the
target
sequence
of
IDO
mRNA
sequence
(UUAACUUCUCAACUCUUUCUC) was selected on the basis of unique sequence
and transfection of siRNA was processed as described previously9. In brief, 50 μl of
OptiMEM I® was combined with 1μl LIPOFECTAMINE 2000™. 50 μl of OptiMEM
I® was combined with 1.25μl of 20μM IDO1 siRNA. These two solutions were then
combined and complexed (all transfection materials from Invitrogen).After 20 min of
complexing, the 100μl OptiMEM I®/IDO siRNA/LIPOFECTAMINE 2000™ mixture
was added to the culture per well. The sequences were listed as follows:
sense,5′-TTAACTTCTCAACTCTTTCTC-3′,
antisense,5′- GAAAGAGTTGAGAAGTTAAAC-3′;
Non targeting control (NTC) sequence:
sense,5’-AACAAGATGAAGAGCACCAA-3’,
antisense,5’-TTGGTGCTCTTCATCTTGTT-3’.
Transfected MSCs were plated into 6-well plates for 12 hours, then co-cultured with
CD5+ B cells or CD5- B cells for additional 60 hours. MSCs and B cells were
harvested respectively. The knockdown efficiency of IDO1 in MSCs was validated by
qRT-PCR; the proliferation or survival of CD5+ B cells or CD5- B cells was
measured by flow cytometry.
References
1. Weng JY, Du X, Geng SX, Peng YW, Wang Z, Lu ZS, et al.Mesenchymal stem
cell as salvage treatment for refractory chronic GVHD. Bone Marrow Transplant
2010; 45(12): 1732-1740.
2.
Yu W, Chen Z, Zhang J, Zhang L, Ke H, Huang L, et al. Critical role of
phosphoinositide 3-kinase cascade in adipogenesis of human mesenchymal stem
cells. Mol Cell Biochem 2008; 310(1-2): 11-18.
3.
Zhang AX, Yu WH, Ma BF, Yu XB, Mao FF, Liu W, et al. Proteomic
identification of differently expressed proteins responsible for osteoblast
differentiation from human mesenchymal stem cells. Mol Cell Biochem 2007;
304(1-2): 167-179.
4.
Baird K, Steinberg SM, Grkovic L, Pulanic D, Cowen EW, Mitchell SA, et al.
National Institutes of Health chronic graft-versus-host disease staging in severely
affected patients: organ and global scoring correlate with established indicators of
disease severity and prognosis. Biol Blood Marrow Transplant 2013; 19(4):
632-639.
5.
Filipovich AH, Weisdorf D, Pavletic S, Socie G, Wingard JR, Lee SJ, et al.
National Institutes of Health consensus development project on criteria for
clinical trials in chronic graft-versus-host disease: I. Diagnosis and staging
working group report. Biol Blood Marrow Transplant 2005; 11(12): 945-956.
6.
Piboonniyom SO, Treister N, Pitiphat W, Woo SB. Scoring system for monitoring
oral lichenoid lesions: a preliminary study. Oral Surg Oral Med Oral Pathol Oral
RadiolEndod 2005; 99(6): 696-703.
7.
Pavletic SZ, Martin P, Lee SJ, Mitchell S, Jacobsohn D, Cowen EW, et al.
Measuring therapeutic response in chronic graft-versus-host disease: National
Institutes of Health Consensus Development Project on Criteria for Clinical Trials
in Chronic Graft-versus-Host Disease: IV. Response Criteria Working Group
report.Biol Blood Marrow Transplant 2006; 12(3): 252-266.
8.
Lee S, Cook EF, Soiffer R, Antin JH. Development and validation of a scale to
measure symptoms of chronic graft-versus-host disease.Biol Blood Marrow
Transplant 2002; 8(8): 444-452.
9.
Ohki EC, Tilkins ML, Ciccarone VC, Price PJ. Improving the transfection
efficiency of post-mitotic neurons. J Neurosci Methods 2001; 112(2): 95-99.