CVR-2015-479R1
CARD11
CARD12
CARD14
CARD15
CARD17
IL-1β
IL-6
MCP-1
α-tubulin
Supplementary Materials
1. Supplementary Methods
Table S1. Primers used in this study.
Gene Forward
CARD3
CARD4 aaatcatcccccacaggag tttaagggtgaagccaaagg
CARD5
CARD6
CARD9
CARD10 gagcagctgcaaacgactaa attttgtggccctccaaga ctctgtgcaggagggtaagc tgcagggcgagctacagt tctccagagcgagtttcttctt tgatctccaagagatgaagttgg gagaaactccgctccatgac tgtggagtcaccgcaaaac attttgtggccctccaaga gcccatcctctgtgactcat gctaccaaactggatataatcagga catccacgtgttggctca tctaacccgttgctatcatgc
Reverse ggtccaggagaaccagtgtt ggcagacaaatcaggattcag gtccacaaagtgtcctgttctg ttgaaagtgggcaacatgg tccgtagggagaagatggtg gcagatcctccatctcttgc tgttttctgaccggctgac gatcaaattgtgaagattctgtgc cctcatccagactctgttcca tcctctgtgcctggaactct ttgaaagtgggcaacatgg aggccacaggtattttgtcg ccaggtagctatggtactccagaa gatcatcttgctggtgaatgagt gccatgttccaggcagtag
1

CVR-2015-479R1
1.1 Histopathology
For immunohistochemical staining, vein grafts and control veins sections were labeled with antibodies against galectin-3 (Mac-2, Santa Cruz Biotechnology, Santa
Cruz, CA), PCNA (Cell Signaling Technology, Beverly, MA) and α-smooth muscle actin (α-SMA, Sigma-Aldrich, St. Louis, MO). Diaminobenzidine tetrahydrochloride
(DAB) was used for the color reaction. For immunofluorescence, frozen vein grafts and control veins sections were labeled with primary antibodies against F4/80
(Abcam, Cambridge, MA), CARD9 (Santa Cruz Biotechnology, Santa Cruz, CA),
IL-6 (Santa Cruz Biotechnology, Santa Cruz) and IL-1 β (Santa Cruz Biotechnology,
Santa Cruz, CA), and then incubated with a fluorescein isothiocyanate (FITC)- and tetramethylrhodamine isothiocyanate (TRITC)-conjugated secondary antibody
(Jackson ImmunoResearch Laboratories, West Grove, PA). Images were captured by use of a Nikon Labophot 2 microscope equipped with a Sony CCD-Iris/RGB color video camera attached to a computerized imaging system and analyzed by ImagePro
Plus 3.0 (Nikon, Tokyo, Japan).
1.2 Cell isolation and culture
Macrophages were obtained from bone marrow of wild type or CARD9 knockout mice and were maintained in Dulbecco’s modified Eagle’s medium (DMEM,
HyClone, Waltham, MA) medium with 10% fetal calf serum supplemented with penicillin-streptomycin and 50 ng/ml of macrophage colony-stimulating factor
(M-CSF; PeproTech, Rocky Hill, NJ) at 37 o
C and humidified 5% CO
2
as described
1
.
Briefly, 8- to 10-week-old mice were sacrificed with CO
2 narcosis, and bone marrow cells were isolated from both tibia and femur bones. Cell suspensions were filtrated and then underwent Ficoll gradient centrifugation to remove erythrocytes and non-lymphocytes. Mouse vein SMCs were isolated from vena cava of C57BL/6 wild type male mice and cultured in DMEM supplemented with 10% fetal bovine serum at
37 o
C and humidified 5% CO
2
2
. Briefly, 8- to 10-week-old mice were sacrificed with
CO
2 narcosis, and then vena cava was excised and washed in ice-cold PBS solution.
The media of the vein was minced into small pieces and digested in a buffer with
0.2% collagenase type I for 20 minutes at 37
o
C with agitation. The dispersed cells were incubated in culture dishes. SMCs of human saphenous vein were also isolated by collagenase digestion techniques described above.
1.3 Annexin V/PI staining
The death of SMCs in response to mechanical stretch was measured by annexin V and
PI staining as previously described
3
. Briefly, the gels were cut into small pieces and stained with annexin V-APC (ebiosicience, San Diego, CA) in annexin V binding buffer on ice for 20 min in the dark. The annexin V labeling solution was then removed and the cells were washed with binding buffer for one time. PI staining solution was added, and Hoechst 33342 staining was used for measuring the total number of cells. Cells were immediately viewed with a 40x objective using a Leica laser confocal microscope. Six fields of cells for each condition (more than 500 cells) were counted.
2

CVR-2015-479R1
1.4 CARD9 knockdown
THP1 cells were maintained in RPMI 1640 medium (Invitrogen, Carlsbad, CA, USA) with 10% fetal cal serum were transfected with human CARD9 siRNA (s34524,
Invitrogen, Carlsbad, CA, USA) or control siRNA using the Lonza 4D-Nucleofector
X-unit system (Basel, Swiss), according to the manufacturer’s instruction. Briefly, 1 ×
10
6
cell pellet was re-suspended in 100 μl SG Cell Line buffer, and then 20 pmol siRNA was added to the cell suspension. The mixture was transferred to the reaction cuvette, and electroporation was carried out. 36 hours after electroporation, protein was harvest and knockdown efficiency was confirmed by Western Blotting analysis.
CARD9-knockdown SMCs were treated with H
2
O
2
-induced necrotic HSVSMCs for additional 20 hours before RNA harvest, for detecting the RNA expression of pro-inflammatory cytokines.
1.5 Western blotting
Macrophages were lysed in RIPA buffer and equal amounts of protein were loaded onto SDS-polyacrylamide gel, separated by 10% SDS-PAGE and transferred onto nitrocellulose membranes. Membranes were incubated with specific antibodies against CARD9 (Santa Cruz Biotechnology, Santa Cruz, CA), phosphorylated NF-κB p65 (Ser 536), NF-κB p65, phosphorylated JNK (Thr183/Tyr 185), JNK, phosphorylated ERK 1/2 (Thr 202/Tyr 204), ERK 1/2, (Cell Signaling Technology,
Beverly, MA) and GAPDH (Sigma-Aldrich, St. Louis, MO) at 4°C overnight, and then with infrared Dye-conjugated secondary antibodies (Rockland Immunochemicals,
Gilbertsville, PA) for 1 hour at room temperature.
1.6 NF-κB Luciferase assay
Macrophages were infected with adenovirus expressing NF-κB luciferase reporter
(Ad-NF-κB-Luc) as described previously
4
. Briefly, macrophages from WT and
CARD9 knockout mice were infected with Ad-NF-κB-Luc at a multiplicity of infection of 5 for 24 hours. Macrophages alone or with H
2
O
2
-treated vein SMCs were mixed with type I collagen (1.5 mg/ml) at the ratio of 1:0 (macrophages: necrotic
SMCs), 1:3 (macrophages: necrotic SMCs). The total number of cells was constant at the concentration of 1x10
5
cells/ml. After co-culture for 48 hours, the cells were released by digestion with collagenase I, which were then harvested and lysed with reporter lysis buffer. 5 µg total protein of each sample underwent luciferase activity assay according to the manufacturer's protocol (Promega, Madison, WI).
1.7 SMCs migration assay
SMCs (5x10
4
) were seeded to the top chambers of 24-well transwell plates (8-μm pore size, Cell Biolabs, USA), and conditional media derived from WT and CARD9
KO BMDMs stimulated with necrotic SMCs for 20 hours were added to the bottom chambers. After incubation for 12 hours, top (non-migrated) SMCs were removed by gently swabbing with cotton swabs, and bottom (migrated) cells were fixed and stained with DAPI to visualize and count.
3

CVR-2015-479R1
1.8 SMCs proliferation assay
SMCs grown on coverslips were stimulated with conditional media for 10 hours, and then incubated with 10 μM bromodeoxyuridine (BrdU, Sigma-Aldrich, St. Louis, MO) for 2 hours, Cells were fixed with 4% paraformaldehyde and stained with mouse anti-BrdU (1:200, Millipore, Boston, MA) after nucleus denaturizing by 2M HCl and
0.1M sodium tetraborate (pH 8.5), according to the manufacturer’s instructions.
Immunofluorescence staining was performed with FITC-labled secondary antibody, and DAPI staining was used for measuring the total number of cells.
4

CVR-2015-479R1
References
1. Weischenfeldt J,Porse B. Bone Marrow-Derived Macrophages (BMM): Isolation and
2.
3.
4.
Applications .
CSH Protoc 2008; 2008 : pdb prot5080.
Cheng J,Du J. Mechanical stretch simulates proliferation of venous smooth muscle cells through activation of the insulin-like growth factor-1 receptor .
Arterioscler Thromb Vasc Biol
2007; 27 : 1744-1751.
Lin J, Li H, Yang M, Ren J, Huang Z, Han F, Huang J, Ma J, Zhang D, Zhang Z, Wu J, Huang
D, Qiao M, Jin G, Wu Q, Huang Y, Du J,Han J. A role of RIP3-mediated macrophage necrosis in atherosclerosis development .
Cell Rep 2013; 3 : 200-210.
Zhang L, Ma Y, Zhang J, Cheng J,Du J. A new cellular signaling mechanism for angiotensin II activation of NF-kappaB: An IkappaB-independent, RSK-mediated phosphorylation of p65 .
Arterioscler Thromb Vasc Biol 2005; 25 : 1148-1153.
5

CVR-2015-479R1
2. Supplementary Figure legends
Figure S1 Mechanical stretch induced little death of smooth muscle cells (SMCs) with 2-D culture condition. TUNEL staining of SMCs cultured on elastic membranes and subjected to mechanical stretch (15% elongation, 12 h). The bar graph was expressed as the percent of TUNEL-positive cells to total cells. Data represent the mean±SEM; three independent experiments were performed. Scale bar:
50 μm.
Figure S2 Mechanical stretch induced necrosis of SMCs with 3D-culture. SMCs cultured on 3-D peptide gel were subjected to mechanical stretch (15% elongation,
12h). (A) TUNEL staining of SMCs, and Z-VAD concentration was 40 μM. The bar graph was expressed as the percent of TUNEL-positive cells to total cells. Data represent the mean±SEM; three independent experiments were performed. (B) The death of SMCs under mechanical stretch was measured by annexin V and PI staining.
Nuclei were stained with DAPI. Three independent experiments were performed.
Scale bar: 50 μm. **, p<0.01.
Figure S3 Inflammatory cytokine expression was induced in vein grafts and in macrophages by necrotic SMC stimulation. (A) qPCR of IL-1β, IL-6 and MCP-1 in control veins and vein grafts at 3 d, 1 w and 4 w. Data represent the mean±SEM fold induction compared with the control after normalization to
 α-tubulin; n=6 per group.
(B) Bone marrow-derived macrophages (BMDMs) derived from wild-type (WT) mice were stimulated with necrotic SMCs (H
2
O
2
treated for 8 h) for 20 h. (C) SMCs cultured in 3D-collagen gel were subjected to mechanical stretch at 15% elongation for 12 h, then the cells were released from gel by digestion with type I collagenase.
The stretched SMCs were used to treat BMDMs for 20 h. The mRNA levels of IL-1β,
IL-6 and MCP-1 were evaluated with qPCR, and expressed as fold induction compared with the control after normalization to
 α-tubulin. Data represent the mean±SEM; five independent experiments were performed. Scale bar: 50 μm. *, p<0.05, **, p<0.01.
Figure S4 Few CD11c-positive dendritic cells infiltrated in vein grafts.
Immunofluorescence assay of expression of CD11c or F4/80 in grafted veins at 14 d with specific antibodies (anti-CD11c, BD Bioscience, San Jose, CA) and Alexa Fluor
546-labeled secondary antibody (Invitrogen, Grand Island, NY). Sections of mouse thymus was used for positive staining of CD11c. Nuclei were stained with DAPI; n=6 per group. Scale bar: 50 μm.
6

CVR-2015-479R1
Liu et al. Figure S1
7

CVR-2015-479R1
Liu et al. Figure S2
8

CVR-2015-479R1
Liu et al. Figure S3
9

CVR-2015-479R1
Liu et al. Figure S4
10