ynecological Endocrinology, 2012; 28(4): 305–309
Copyright © 2012 Informa UK, Ltd.
ISSN 0951-3590 print/ISSN 1473-0766 online
DOI: 10.3109/09513590.2011.631624
ENDOMETRIOSIS
XRCC1 399*Arg-related genotype and allele, but not XRCC1 His107Arg,
XRCC1 Trp194Arg, KCNQ2, AT1R, and hOGG1 polymorphisms, are
associated with higher susceptibility of endometriosis
Yao-Yuan, Hsieh1,2, Chi-Chen Chang2, Shih-Yin Chen3, Chih-Ping Chen4, Wen-Hsin Lin5 & Fuu-Jen Tsai3,6
Gynecol Endocrinol Downloaded from informahealthcare.com by University of Sydney on 07/09/12
For personal use only.
1School of
Chinese Medicine, College of Chinese Medicine, China Medical University, Taichung, Taiwan, 2Division of Infertility Clinic,
Hsieh Yao-Yuan Women’s Hospital, Taichung, Taiwan, 3Graduate Institute of Chinese Medical Science, China Medical University, China
Medical University Hospital, Taichung, Taiwan, 4Department of Obstetrics and Gynecology, Mackay Memorial Hospital, Taipei, Taiwan,
5School of Pharmacy Undergraduate Program Department of Medicine, China Medical University, Taichung, Taiwan, and
6Department of Health and Nutrition Biotechnology, Asia University, Taichung, Taiwan
prevalence of endometriosis is around 10% in the general population [1]. Endometriosis displays some features of malignancy,
including altered morphology, disregulated growth, local invasion and aggressive spread to distant organs. Endometriosis
might be caused by an interaction between multiple genes as well
as environmental factors. Altered or defected DNA-repairing
system is essential for the self-defense against tumorigenesis.
Angiogenesis might be also related with the development of
endometriosis.
DNA damage plays a major role in mutagenesis, carcinogenesis
and aging. Repairing DNA damage is critical for cell proliferation
and prevention of cell malformations. The integrity of damaged
genome is typically restored as a consequence of the action of
certain DNA-repairing enzymes. The sensitivity to mutagens and
efficacy of DNA repair are affected by variation in several genes,
including X-ray repair cross-complementing group 1 (XRCC1)
and human 8-oxoguanine glycosylase 1 (hOGG1) genes. XRCC1
is a base excision repair protein that plays a central role in the
repair of oxidative DNA base adducts, and also a negative regulator of apoptosis [2]. The hOGG1 gene encodes glycosylase of
base excision repair and specifies a key protein in homologues
recombination repair. The hOGG1 gene encodes a DNA glycosylase involved in the excision repair of 8-hydroxy-2′-deoxyguanine
(8-OH-dG) from oxidatively damaged DNA [3]. The hOGG1 is a
key component of the base excision repair pathway and catalyzes
the removal of 8-OH-dG [4].
The KCNQ gene family comprises voltage-gated potassium
channels, which were expressed in epithelial tissues (KCNQ1,5),
inner ear structures (KCNQ1,4) and the brain (KCNQ2-5 [5]).
The M channels, important regulators of neuronal excitability,
are voltage-gated potassium channels composed of KCNQ2-5
Keywords: AT1R, Endometriosis, hOGG1, KCNQ2, polymorphism,
subunits. KCNQ2 is crucial for their functions in controlling
XRCC1
neuronal excitability. Mutations in KCNQ2 genes might be associated with benign familial neonatal convulsions, dominantly
Introduction
inherited epilepsy and myokymia. Mutations in KCNQ2 genes
Endometriosis is a pathologic gynecologic entity typical of have been found to be correlated with some instability for neurona
women in reproductive age, associated with many polygenic/ excitability, such as benign familial neonatal convulsions, domimultifactorial alterations but its etiology remains unclear. The nantly inherited epilepsy and myokymia [6].
X-ray repair cross-complementing group 1 (XRCC1) and human
8-oxoguanine glycosylase 1 (hOGG1) play important roles in base
excision repair. KCNQ genes comprising voltage-gated ionchannels related with cell stability. Angiotensin II type 1 receptor
(AT1R) is related with angiogenesis, which influence endometriosis growth, invasion and regression. We aimed to investigate
whether these polymorphisms were associated with endometriosis susceptibility. Women were divided [1]: endometriosis
(n = 136 [2]); non-endometriosis groups (n = 112). XRCC1 (codon
107, 194, 399), hOGG1, KCNQ2, AT1R polymorphisms were
amplified by PCR and detected by electrophoresis after restriction enzyme (RsaI, HpaII, MspI, Fnu4HI, Ava II, Dde I)
digestions. Genotypes and allelic frequencies in both groups
were compared. Proportions of XRCC1 Arg399Gln*GG/GA/AA
and G/A allele between both groups were [1]: 41.9/53.7/4.4%
and 68.8/31.2% [2]; 30.4/54.5/15.1% and 57.6/42.4% (p < 0.05).
Other 5 polymorphisms (XRCC1 codon 107 and 194, hOGG1,
KCNQ2, and AT1R) between both groups were non-significantly
different. Proportions of XRCC1 107*AA/AG/GG and XRCC1
194*TT/TC/CC between both groups were [1]: 3.7/27.2/69.1%
and 5.8/34.6/59.6% [2]; 2.6/21.4/75.8% and 11.6/37.5/50.9%.
HOGG1*CC/CG/GG, KCNQ2*AA/AC/CCC and AT1R*AA/AC/CC
were [1]: 14.8/42.6/42.6, 14/41.9/44.1 and 92.6/7.4/0% [2];
11.6/50/38.4, 17/50/33 and 100/0/0%. We concluded that XRCC1
399 Arg-related genotype and allele are correlated with higher
susceptibility to endometriosis, which suggested its association with endometriosis pathogenesis. XRCC1 107 and 194,
hOGG1, KCNQ2, and AT1R are not associated with endometriosis
susceptibility.
*Capsule: XRCC1 codon Arg399Gln, but not XRCC1 His107Arg, XRCC1 Trp194Arg, KCNQ2, AT1R, and hOGG1 polymorphisms, is associated with
higher susceptibility of endometriosis.
Correspondence: Fuu-Jen Tsai, M.D., Ph.D., Department of Medical Genetics, China Medical University Hospital, No. 2 Yuh-Der Road, Taichung, Taiwan.
Tel: 886-4-22052121; ext. 2041. Fax: 886-4-22033295. E-mail: d0704@mail.cmuh.org.tw
305
Cyt
C
100 + 51
Ade
A
*F and R indicate forward and reverse primers.
AT1R codon 1166
R: CGGTTCAGTCCACATCCTGCA
94/30
58/30
72/30
Dde I (37°C/1 h)
Pro
C
246
151 + 53 + 42
151
Pro
A
Ava II (37°C /1 h)
72/30
58/30
94/30
F: CATGGAGTTCCTGCGGCA
KCNQ2 codon 718
R: GGAAGGTGCTTGGGGAAT
R: TCGGAGTCGGTGTCTGACTCTC
F: TTGAGGTTGAGTGACATGTTCGA
200
100 + 100
Ser
Cys
G
Gln
72/30
R: TGTCCCGCTCCTCTCAGTAG
F: CCCCA AGTACAGCCAGGTC
94/30
60/30
72/40
55/40
95/40
R: TCAGACCCAGGAATCTGAGC
C
A
MspI (37°C/3 h)
Fnu4HI (37°C/1 h)
Arg
G
219 + 119
242
147 + 95
Arg
Trp
T
C
870
338
Arg
G
HpaII(37/3 h)
72/30
58/30
94/30
F: CAGACAAAGATGAGGCAGAGG
F: ACTGTCACTAGTCTCACCAG
hOGG1 codon 326
After the survey of 6 genetic polymorphisms, except for
XRCC1 Arg399Gln, genotype proportions of other 5 gene
polymorphisms (XRCC1 His107Arg, XRCC1 Trp194Arg,
hOGG1, KCNQ2, and AT1R) between both groups were nonsignificantly different (Table II andIII). Distributions of XRCC1
XRCC1 codon 399
Results
R: AGTCTGCTGGCTCTGGGCTGG
Pre-menopausal Taiwan women with surgically and histologically diagnosed endometriosis were included. All patients were
divided into two groups [1]: severe endometriosis (revised
American Fertility Society classification stage IV, n = 136 [2]);
non-endometriosis group (n = 112). The non-endometriosis
statuses were confirmed after detail ultrasonography. All
women accepted the peripheral blood sampling for genotype
analyses. The genomic DNA was prepared from peripheral
blood leukocytes using a genomic DNA isolation kit (Blossom,
Taipei, Taiwan). A total of 50 ng genomic DNA was mixed with
20 pmol of each polymerase chain reaction (PCR) primer in
a total volume of 25 μl containing 10 mM Tris-HCL pH 8.3,
50 mM potassium chloride, 2.0 mM magnesium chloride,
0.2 mM each deoxyribonucleotide triphosphate, and 1 U DNA
polymerase (Amplitag; Perkin-Elmer, Foster City, CA, USA).
The PCR primer sequences and conditions of each primer were
listed in Table I.
After PCR amplification, the XRCC1 (codon 107, 194, and
399), hOGG1 codon 326, KCNQ2 codon 718, AT1R codon 1166
gene polymorphisms were analyzed by restriction digestion with
restriction enzymes (RsaI, HpaII, MspI, Fnu4HI, Ava II, Dde I,
New England Biolabs, Inc, Beverly, MA). The reaction was then
incubated at 37°C, and then 10 μl of the digested products were
loaded into a 3% agarose gel with ethidium bromide staining and
separated by electrophoresis. The individual PCR conditions,
following electrophoreses and base pairs for their wild and SNP
types were listed in Table I. Genotypes and allelic frequencies
for XRCC1, hOGG1, KCNQ2, and AT1R gene polymorphisms
in both groups were compared. Correlations of these gene polymorphisms and endometriosis were evaluated. Allelic frequencies
are expressed as a percentage of the total number of alleles. The
SAS package with χ2 and Fisher’s extract tests were utilized for
statistical analyses. A p value < 0.05 was considered statistically
significant.
XRCC1 codon 194
Patient and methods
DNA fragment
size (bp)
660 + 210
Angiotensin (Ang) is a well-known activator of smooth
muscle in the vasculature. Ang II is locally produced in various
tissues; whereas its role upon the regulation of tissue metabolism
is still indefinite. Ang II type 1 receptor (AT1R) is related with
the regulation of vascular tone. Ang II signaling contributes to
cell proliferation and inhibition of the insulin signaling pathways
through AT1R [7]. Activation of AT1R stimulates catecholamine
systems within both central and peripheral tissues that are
associated with blood pressure control [8]. Recent studies have
revealed the role of AT1R in the control of energy homeostasis
and lipid metabolism [9].
Genetic variations in DNA-repairing (XRCC1, hOGG1), ionchannels, cell stability (KCNQ2), and vascular-related (AT1R)
genes might be involved in the pathogeneses of endometriosis. In
this study, we firstly aimed to evaluate whether these gene polymorphisms are attractive markers for predicting the susceptibility
of endometriosis. To the best of our knowledge, this is the first
survey in this field.
Table I. The primer sequences, polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) conditions for XRCC1, hOGG1, KCNQ2, and AT1R gene polymorphisms.
Restriction
Polymorphisms (locations) Primers sequences (5′->3′)
Denature (°C/sec) Annealing (°C/sec) Extension (°C/sec) enzyme (°C/min)* SNP sequence Allelic variants
A
His
XRCC1 codon 107
F: TTGACCCCCAGTGGTGCT
94/30
63/30
72/30
RsaI(37°C/1 h)
Gynecol Endocrinol Downloaded from informahealthcare.com by University of Sydney on 07/09/12
For personal use only.
306 Y.-Y. Hsieh et al.
Gynecological Endocrinology
Gynecol Endocrinol Downloaded from informahealthcare.com by University of Sydney on 07/09/12
For personal use only.
XRCC & KCNQ in endometriosis 307
Table II. Genotypes and allelic frequencies for XRCC1 His107Arg,
Try194Arg, and Arg399Gln gene polymorphisms in women with and w
ithout endometriosis.
Endometriosis n = 136 (%) Controls n = 112 (%) p value*
XRCC1 107
AA
5 (3.7%)
3 (2.6%)
NS
AG
37 (27.2%)
24 (21.4%)
GG
94 (69.1%)
85 (75.8%)
Allele A
47 (17.3%)
30 (13.3%)
NS
Allele G
225 (82.7%)
194 (86.6%)
XRCC1 194
TT
8 (5.8%)
13 (11.6%)
NS
TC
47 (34.6%)
42 (37.5%)
CC
81 (59.6%)
57 (50.9%)
Allele T
63 (23.2%)
65 (30.4%)
NS
Allele C
209 (76.8%)
153 (69.6%)
XRCC1 399
GG
57 (41.9)
34 (30.4)
0.007
GA
73 (53.7)
61 (54.5)
AA
6 (4.4)
17 (15.1)
Allele G
187 (68.8)
129 (57.6)
0.01
Allele A
85 (31.2)
95 (42.4)
*χ2 test.
Table III. Genotypes and allelic frequencies for hOGG1 Ser326Cys,
KCNQ2 Pro718Pro, and AT1R Ade1166Cyt genes polymorphisms in
women with and without endometriosis.
Endometriosis n = 136 (%) Controls n = 112 (%) p value*
hOGG1 326
C/C
20 (14.8%)
13 (11.6%)
NS*
C/G
58 (42.6%)
56 (50%)
G/G
58 (42.6%)
43 (38.4%)
Allele C
98 (36%)
82 (36.6%)
NS*
Allele G
KCNQ2 718
AA
AC
CC
Allele A
Allele C
AT1R 1166
AA
AC
CC
Allele A
Allele C
174 (64%)
142 (63.4%)
19 (14%)
57 (41.9%)
60 (44.1%)
95 (34.9%)
177 (65.1%)
19 (17%)
56 (50%)
37 (33%)
94 (42%)
130 (58%)
NS*
126 (92.6%)
10 (7.4%)
0
262 (96.3%)
10 (3.7%)
112 (100%)
0
0
224 (100%)
0
NS†
NS*
NS†
*χ2 test; †Fisher’s extract test.
107*A homozygote/heterozygote/G homozygote and A/G allele
in both groups were [1]: 3.7/27.2/69.1% and 17.3/82.7% [2];
2.6/21.4/75.8% and 13.3/86.6%, respectively (non-significant
difference, Table II). Proportions of XRCC1 194*T homozygote/heterozygote/C homozygote and T/C allele in both groups
were [1]: 5.8/34.6/59.6% and 23.2/76.8% [2]; 11.6/37.5/50.9%
and 30.4/69.6%, respectively (non-significant difference,
Table II). In contrast, proportions of XRCC1 399*G homozygote/heterozygote/A homozygote and G/A allele in both groups
were [1]: 41.9/53.7/4.4% [2]; 30.4/54.5/15.1%, respectively (p
value = 0.007). Proportions of XRCC1 Arg399Gln*G/A allele
between both groups were [1]: 68.8/31.2% [2]; 57.6/42.4%
Copyright © 2012 Informa UK, Ltd.
(p = 0.01, Table II). These findings suggest that the Arg-related
genotype and allele of XRCC1 Arg399Gln polymorphism are
associated with higher susceptibility to endometriosis.
Furthermore, genotype proportions and allele frequencies
between both groups were also non-statistically different in
hOGG1 codon 326, KCNQ2 codon 718 and AT1R codon 1166 gene
polymorphisms (Table III). Proportions of hOGG1 Ser326Cys*C
homozygote/heterozygote/G homozygote and C/G allele in both
groups were [1]: 14.8/42.6/42.6% and 36/64% [2]; 11.6/50/38.4%
and 36.6/63.4%, respectively (Table III). Proportions of KCNQ2
Pro718Pro*A homozygote/heterozygote/C homozygote and A/C
allele in both groups were [1]: 14/41.9/44.1% and 34.9/65.1% [2];
17/50/33% and 42/58%, respectively (Table III). Distributions
of AT1R Ade1166Cyt*A homozygote/heterozygote/C homozygote and A/C allele in both groups were [1]: 92.6/7.4/0% and
96.3/3.7% [2]; 100/0/0% and 100/0%, respectively (Table III).
Discussion
Endometriosis is a complex multifactorial disease associated with
genetic alterations in neovascularization. This disease presents
some characteristics of malignancy, such as development of local
and distant foci and attachment to and invasion of other tissues
with subsequent damage to the target organs [10]. Similar to tumor
metastases, endometriotic implants require neovascularization
to become established, grow and invade tissues. Neovascular
processes are prominent in the endometriosic tissue.
Complex DNA-repair systems target is to defend tissue from
the DNA damage resulted from mutagenic and carcinogenic environment. Genetic variants of DNA-repair genes might contribute
to tumorigenesis. Some polymorphisms involved in the repair
of alkylating DNA adduct and DNA base damage might be
associated with modulating or decreasing the cancer risks [11].
Endometriosis involves a complex interaction or compromise
between cell metapasia, genetic defect, DNA repair, cell stability
and angiogenesis [12]. Deficient DNA-self repairing or defense
process against peritoneal/ovarian metaplastic cells or retrograde
endometrial cells during menstruation might be involved with
the pathophysiology of endometriosis.
Compromised DNA-repair capacity may play an important
role in the pathogenesis of endometriosis. Amongst DNA-repair
genes, XRCC1 play an important role in the excision or repair
of both damaged bases and single-strand breaks of DNA after
chemical or other carcinogen exposure [11,13]. XRCC1 protein
might interact with DNA ligases in recognition and rejoining of
DNA strand breaks [14]. XRCC1 is essential for the excision or
repair of both damaged bases and single-strand breaks of DNA
after chemical or other carcinogen exposure [13]. Cells lacking
the XRCC1-related activity are hypersensitive to DNA damage.
Genetic variations in DNA-repair genes, such as XRCC1, might
lead to inter-individual variation in DNA-repair capacity and
modify the associations between exogenous and endogenous
carcinogens and endometriosis risk. XRCC1 is thought to be
involved with DNA single-strand beak (SSB) repair, and plays an
important role in the base excision repair (BER) pathway. In coordinating BER, XRCC1 protein is proposed to interact with DNA
ligase III in recognition and rejoining of DNA strand breaks.
XRCC1 gene is located on chromosome 19q13.2, which
contains 17 exons as well as a large number of single-nucleotide
polymorphisms (SNPs [15]). The XRCC1 gene of human, which
encodes a protein that plays a central role in the single-strand
break repair or base excision repair pathway [16], was identified
by its ability to restore DNA repair [15]. XRCC1 and three other
Gynecol Endocrinol Downloaded from informahealthcare.com by University of Sydney on 07/09/12
For personal use only.
308 Y.-Y. Hsieh et al.
DNA-repair enzymes are involved in the excision and repair of
single-strand breaks and in recombinational repair pathways [17]:
DNA ligase I at its 3′ end, DNA polymerase β, and poly adenosine
diphosphate (ADP)-ribose polymerase (PARP). XRCC1 mutants
display sensitivity to alkylating agents and ionizing radiation and
exhibit elevated levels of sister chromatid exchange in the Chinese
hamster ovary cell lines. Such alterations might be associated with
increased cancer risk [14]. Furthermore, variants of XRCC1 gene
might contribute to ionizing radiation susceptibility as measured
by prolonged cell cycle G2 delay [18]. Many XRCC1 genetic polymorphisms have been documented to be associated with alterative DNA-repair capacity [14].
HOGG1 is also essential for the base excision/repair pathway
after DNA damage. Some investigators demonstrated the hOGG1
Ser326Ser and Ser326Cys genotypes were risk factors for superficial bladder cancer recurrence compared with the Cys326Cys
genotype [19]. Patients with atrophic gastritis in conjunction
with the hOGG1 Cys allele might have a higher susceptibility to
gastric cancer [20]. KCNQ-type potassium channels generate the
M-current voltage, which is essential in regulating neuron cells
excitability. Ability of KCNQ channels is important in modulating
cell excitability. KCNQ-potassium channels and M-currents
could stabilize the neuronal resting potential and prevent repetitive firing of action potentials. Mutations in the voltage-gated
potassium/M-channel KCNQ2 gene has been found to cause idiopathic generalized epilepsy, the benign familial neonatal convulsions, benign familial neonatal convulsions [6]. Impaired KCNQ2
channels cause neuronal hyperexcitability, manifested as epileptic
seizures and myokymia. KCNQ2 genes have been emerged as
novel targets for numerous cell-stability disorders [21].
Neoangiogenesis is prominent in endometrisic tissues, which
suggested the affinity between vascular-related genes and endometriosis susceptibilities. Renin-angiotensin system is a central
component of the physiological and pathological responses of
cardiovascular system. Its primary effector hormone, Ang II,
mediates not only immediate physiological effects of vasoconstriction and blood pressure regulation. Many evidences suggest
an involvement in inflammation, endothelial dysfunction, atherosclerosis, hypertension, and congestive heart failure. AT1R might
influences Doppler blood flow parameters of carotid and brachial
arteries in patients with myocardial infarction [22]. Defect in
AT1R expression may further alter downstream signaling pathways as well as responsible for the development of e hypertension [8]. AT1R A1166C polymorphism is a potential genetic
marker for increased susceptibility to renal complications in type
2 diabetes [23] and hypertensive heart disease [24].
XRCC1 polymorphisms were associated with numerous disorders, including breast cancer [25], lung cancer [26], squamous
cell carcinoma of the head and neck [27], nasopharyngeal
carcinoma [28], esophageal cancer [29] etc. However, the functional significance of XRCC1 SNPs upon endometriosis remains
unknown. Despite the SNPs might not alter the transcript productions, some investigator demonstrated the disequilibrium effects
of certain genotypes might influence the related 3-dimensional
structure and efficiency of the transcripts [30]. In this survey,
our findings support the hypothesis that genetic variation in
XRCC1 Arg399Gln might affect the susceptibility for endometriosis. XRCC1 399*G homozygote and allele are associated
with higher susceptibility to endometriosis. We also observed
a lower percentage of Gln homozygote and allele in the women
with endometriosis compared with the non-endometriosis group.
The A and G alleles might be serving as markers of a functional
variant in a nearby gene.
In conclusion, XRCC1 Arg399Gln polymorphism is correlated
with higher susceptibility to endometriosis. This finding suggested
that XRCC1 Arg399Gln polymorphism might be involved in the
pathogenesis of endometriosis. In contrast, genetic variations for
XRCC1 107 and 194, hOGG1, KCNQ2, and AT1R are not associated with endometriosis susceptibility. These findings provide
a valuable insight into the pathogenesis of endometriosis. Some
DNA-repairing, cell voltage/stability or vascular-related polymorphisms might become useful markers to predict the future
development of endometriosis as well as the modulating or interfering factors.
Declaration of interest: We confirm and declare that all authors
fulfilled the condition for authorship. There was no commercial
support in the process of performing this study and submitting this manuscript. There were no conflicts of interest in our
manuscript.
References
1. Goldman MB, Cramer DW. Current concepts in endometriosis. Prog
Clin Biol Res 1989;323:17–23.
2. Bu D, Tomlinson G, Lewis CM, Zhang C, Kildebeck E, Euhus DM. An
intronic polymorphism associated with increased XRCC1 expression,
reduced apoptosis and familial breast cancer. Breast Cancer Res Treat
2006;99:257–265.
3. Monteiro E, Varzim G, Silva R, da Costa B, Lopes C. Polymorphisms
of the human OGG1 gene in laryngeal cancer: Implications in
radiotherapy response and survival. Rev Laryngol Otol Rhinol (Bord)
2005;126:135–140.
4. Karahalil B, Kocabas NA. hOGG1 SER326CYS genetic polymorphism
in a Turkish population. Arch Toxicol 2005;79:377–380.
5. Strutz-Seebohm N, Seebohm G, Fedorenko O, Baltaev R, Engel J,
Knirsch M, Lang F. Functional coassembly of KCNQ4 with KCNE-betasubunits in Xenopus oocytes. Cell Physiol Biochem 2006;18:57–66.
6. Otto JF, Yang Y, Frankel WN, White HS, Wilcox KS. A spontaneous
mutation involving Kcnq2 (Kv7.2) reduces M-current density and
spike frequency adaptation in mouse CA1 neurons. J Neurosci
2006;26:2053–2059.
7. Igarashi M, Hirata A, Nozaki H, Kadomoto-Antsuki Y, Tominaga M.
Role of angiotensin II type-1 and type-2 receptors on vascular smooth
muscle cell growth and glucose metabolism in diabetic rats. Diabetes
Res Clin Pract 2007;75:267–277.
8. Reja V, Goodchild AK, Phillips JK, Pilowsky PM. Upregulation of
angiotensin AT1 receptor and intracellular kinase gene expression in
hypertensive rats. Clin Exp Pharmacol Physiol 2006;33:690–695.
9. Yvan-Charvet L, Even P, Lamandé N, Ferré P, Quignard-Boulangé A.
Preventionofadiposetissuedepletionduringfooddeprivationinangiotensin
type 2 receptor-deficient mice. Endocrinology 2006;147:5078–5086.
10. Barlow DH, Kennedy S. Endometriosis: New genetic approaches and
therapy. Annu Rev Med 2005;56:345–356.
11. Jiao L, Bondy ML, Hassan MM, Wolff RA, Evans DB, Abbruzzese JL, Li
D. Selected polymorphisms of DNA repair genes and risk of pancreatic
cancer. Cancer Detect Prev 2006;30:284–291.
12. Ferrero S, Ragni N, Remorgida V. Antiangiogenic therapies in
endometriosis. Br J Pharmacol 2006;149:133–135.
13. Li Y, Marion MJ, Zipprich J, Freyer G, Santella RM, Kanki C, BrandtRauf PW. The role of XRCC1 polymorphisms in base excision repair
of etheno-DNA adducts in French vinyl chloride workers. Int J Occup
Med Environ Health 2006;19:45–52.
14. Qu T, Morimoto K. X-ray repair cross-complementing group 1
polymorphisms and cancer risks in Asian populations: A mini review.
Cancer Detect Prev 2005;29:215–220.
15. Lamerdin JE, Montgomery MA, Stilwagen SA, Scheidecker LK, Tebbs
RS, Brookman KW, Thompson LH, Carrano AV. Genomic sequence
comparison of the human and mouse XRCC1 DNA repair gene regions.
Genomics 1995;25:547–554.
16. Eisen JA, Hanawalt PC. A phylogenomic study of DNA repair genes,
proteins, and processes. Mutat Res 1999;435:171–213.
17. El-Khamisy SF, Masutani M, Suzuki H, Caldecott KW. A requirement
for PARP-1 for the assembly or stability of XRCC1 nuclear foci at sites
of oxidative DNA damage. Nucleic Acids Res 2003;31:5526–5533.
Gynecological Endocrinology
Gynecol Endocrinol Downloaded from informahealthcare.com by University of Sydney on 07/09/12
For personal use only.
XRCC & KCNQ in endometriosis 309
18. Hu JJ, Smith TR, Miller MS, Mohrenweiser HW, Golden A, Case LD.
Amino acid substitution variants of APE1 and XRCC1 genes associated
with ionizing radiation sensitivity. Carcinogenesis 2001;22:917–922.
19. Kim EJ, Jeong P, Quan C, Kim J, Bae SC, Yoon SJ, Kang JW, et al. Genotypes
of TNF-alpha, VEGF, hOGG1, GSTM1, and GSTT1: Useful determinants
for clinical outcome of bladder cancer. Urology 2005;65:70–75.
20. Tsukino H, Hanaoka T, Otani T, Iwasaki M, Kobayashi M, Hara M,
Natsukawa S, et al. hOGG1 Ser326Cys polymorphism, interaction
with environmental exposures, and gastric cancer risk in Japanese
populations. Cancer Sci 2004;95:977–983.
21. Wang K, McIlvain B, Tseng E, Kowal D, Jow F, Shen R, Zhang H,
et al. Validation of an atomic absorption rubidium ion efflux assay for
KCNQ/M-channels using the ion Channel Reader 8000. Assay Drug
Dev Technol 2004;2:525–534.
22. Ozturk O, Ozturk U, Bilici A. The effect of angiotensin II type-1
receptor gene polymorphisms on doppler blood flow parameters of
carotid and brachial arteries in patients with myocardial infarction.
Echocardiography 2006;23:536–541.
23. Buraczynska M, Ksiazek P, Lopatynski J, Spasiewicz D, Nowicka
T, Ksiazek A. Association of the renin-angiotensin system gene
polymorphism with nephropathy in type II diabetes. Pol Arch Med
Wewn 2002;108:725–730.
24. Mettimano M, Romano-Spica V, Ianni A, Specchia M, Migneco A, Savi
L. AGT and AT1R gene polymorphism in hypertensive heart disease.
Int J Clin Pract 2002;56:574–577.
Copyright © 2012 Informa UK, Ltd.
25. Jin MJ, Chen K, Zhang SS, Zhang YJ, Ren YJ, Xu H, Yao KY, et al.
Association of single nucleotide polymorphisms and haplotypes in
DNA repair gene XRCC1 with susceptibility of breast cancer. Zhejiang
Da Xue Xue Bao Yi Xue Ban 2006;35:370–376.
26. Yuan P, Miao XP, Zhang XM, Wang ZH, Tan W, Sun Y, Zhang XR, et al.
XRCC1 and XPD genetic polymorphisms predict clinical responses to
platinum-based chemotherapy in advanced non-small cell lung cancer.
Zhonghua Zhong Liu Za Zhi 2006;28:196–199.
27. Quintela-Fandino M, Hitt R, Medina PP, Gamarra S, Manso L, CortesFunes H, Sanchez-Cespedes M. DNA-repair gene polymorphisms
predict favorable clinical outcome among patients with advanced
squamous cell carcinoma of the head and neck treated with
cisplatin-based induction chemotherapy. J Clin Oncol 2006;24:
4333–4339.
28. Cao Y, Miao XP, Huang MY, Deng L, Hu LF, Ernberg I, Zeng YX, et al.
Polymorphisms of XRCC1 genes and risk of nasopharyngeal carcinoma
in the Cantonese population. BMC Cancer 2006;6:167.
29. Cai L, You NC, Lu H, Mu LN, Lu QY, Yu SZ, Le AD, et al. Dietary
selenium intake, aldehyde dehydrogenase-2 and X-ray repair crosscomplementing 1 genetic polymorphisms, and the risk of esophageal
squamous cell carcinoma. Cancer 2006;106:2345–2354.
30. Shirasawa S, Harada H, Furugaki K, Akamizu T, Ishikawa N, Ito K, Ito
K, et al. SNPs in the promoter of a B cell-specific antisense transcript,
SAS-ZFAT, determine susceptibility to autoimmune thyroid disease.
Hum Mol Genet 2004;13:2221–2231.