BIO430 Analysis of Restriction Digest and Sequencing Prep Laboratory Exercise
Overview
Before we can proceed with further experiments using the purified plasmid DNA, it is important
to verify that the isolated plasmid contains the insert of interest. This is done using restriction
digestion followed by agarose gel electrophoresis. Looking back at earlier steps in the
experiment, a gene or portion of a gene was ligated into the plasmid vector. From previous work,
the size of this insert should be known. By digesting a small amount of the miniprep DNA with a
specific restriction enzyme (BgI II), the insert should be cut out of the vector. Running the
products of the restriction digestion on an agarose gel should give two DNA bands, one the size
of the vector and the other the size of the inserted DNA. If there are more than two bands in any
digest, it may mean that the insert contains a BgI II site. Do the sizes of the excised bands add up
to the size of the original PCR fragment? Alternatively, two similarly sized fragments may
indicate that a mixed culture was used to start the miniprep, instead of an isolated colony.
Experimental Procedure for Electrophoresis
1. Plan your gel electrophoresis experiment. You will be running undigested DNA samples (from
your plasmid minipreps) run next to the digested samples. (see sample gel below).
2. For your undigested DNA samples, combine 5 μl of miniprep DNA with 15 μl of sterile
water.
*DO NOT add loading dye directly to your “stock” of undigested miniprep DNA.
3. Add 5 μl of 5x loading dye to each of the digested (these are the digests you performed last
week and should have stored until this week) and undigested samples.
4. Place your 1% agarose gel (prepared last week) in the electrophoresis chamber. Pour 1X TBE
electrophoresis running buffer into the chamber until it just covers the gel by 1–2 mm.
5. Load 20 μl of each sample and 10 μl of the 500 bp molecular weight ruler according to your
plan on the 1% agarose gel.
6. Connect your electrophoresis chamber to the power supply and turn on the power. Run the gel
at 150 V for approximately 45 minutes.
7. On completion of electrophoresis, visualize the DNA bands (using appropriate safety
equipment) and acquire an image of your gel.
Paste image below and label it.
Results Analysis From the Restriction Digest
Construct a table of your results for each sample that describes the sample’s name, the reaction
conditions, what bands are present, the size of the bands, and the relative intensity of the bands.
Note: Undigested plasmid DNA is usually supercoiled, meaning that the DNA runs through the
gel faster then unsupercoiled (digested or nicked) DNA because it is compacted. Thus, it is
expected that the undigested plasmid samples will appear to be significantly smaller than the
digested plasmids.
Overview of DNA sequencing stage
Sequencing reactions, like PCR, rely on the basic principles of DNA replication and, as such,
require primers to initiate DNA replication. However, sequencing is performed in just one
direction, so instead of a primer pair, sequencing makes use of single oligonucleotides. Each
sequencing reaction will sequence in a single direction, so four sequencing reactions will be set
up for each plasmid, two forward and two in reverse. Since a single sequencing run generates a
read length of 600–800 base pairs (bp), multiple primers for sequencing in both directions are
required to provide full coverage of the gene and to provide increased depth of coverage; thus,
the same region is read in multiple reactions. In this laboratory, two primers have been designed
for either side of the multiple cloning site (MCS) of pJet1.2, one (pJET SEQ F) directed forward
and one in reverse (pJET SEQ R). Two additional primers have been designed to regions of
homology within plant GAPC genes. These primers, like the initial PCR primers, are degenerate
to allow for differences in GAPC sequences between plant species and are directed forward and
reverse from central exons in the GAPC gene of Arabidopsis.
The pJET SEQ F and pJET SEQ R sequencing primers are designed to anneal to the pJet1.2
plasmid outside of the multiple cloning site. The GAP SEQ F and GAP SEQ R sequencing
primers are designed to anneal to plant GAPC genes. The locations of the GAP SEQ primers are
depicted below.
The sequences of the primers that are being used are as follows:
• pJET SEQ F forward sequencing primer 200 μM (blue) sequence:
CGACTCACTATAGGGAGAGCGGC
• pJET SEQ R reverse sequencing primer 200 μM (yellow) sequence:
AAGAACATCGATTTTCCATGGCAG
• GAP SEQ F, GAPC forward sequencing primer 200 μM (red) sequence:
GGHATTGTTGAGGGTCTNATGAC
• GAP SEQ R, GAPC reverse sequencing primer 200 μM (green) sequence:
CCAGTGGTGCTRGGAATGATGTT
Once your group has established which plasmid miniprep you will sequence, make sure that you
label it WELL, and give the sample to Dr. Miranda.