Figure S1 Electrophoretic mobility shift assay (EMSA) of the biotinylated RNAoligonucleotide wt1 following incubation with nuclear extracts from INS-1 cells kept at
rest or glucose stimulated for 30, 60 or 120 min. There was no electrophoretic mobility
shift of the oligo wt1, indicating that nuclear PTB, even from stimulated cells, was not
competent for binding the corresponding consensus motif in ICA512 mRNA 3’-UTR.
Figure S2 a, Western blotting for cytosolic and nuclear PTB, chromogranin A and tubulin in INS-1 cells untreated (-) or treated with siRNA oligos 1+2, 3 or 4 for PTB. Left
and right panels are from different experiments. The additional siRNA oligos 3 and 4 for
rat PTB were selected by Cenix Biosciences with a proprietary algorithm and chemically
synthesized by Ambion. siRNA oligo 3: sense oligo, 5’GGUGAUAACAGGAGCACAGdTdT; antisense oligo, 5’CUGUGCUCCUGUUAUCACCdTdT. siRNA oligo 4: sense oligo, 5’GGCUUCAAGUUCUUCCAGAdTdT; antisense oligo, 5’UCUGGAAGAACUUGAAGCCdTdT. b, Quantitation of PTB, SG and control proteins
upon transfection of INS-1 cells with siRNA oligos 3 and 4 for PTB. Cells were
transfected with either 1 µg siRNA oligo 3 or 4. All proteins were quantified by western
blotting and normalized against -tubulin, except insulin, which was measured by RIA.
The values are from two independent experiments. c, Quantitation of SG proteins and
luciferase activity upon treatment of INS-1 cells with the indicated siRNA oligos. Control
scrambled 21-mer siRNA oligos were synthesized with the Silencer siRNA Construction Kit
(Ambion) using the following cDNA primers: sense primer, 5’AATGCTCGACATGACAGACGGCCTGTCTC; antisense primer, 5’AACCGTCTGTCATGTCGAGCACCTGTCTC. Firefly luciferase (F-Luc) was knockdown
by RNAi with the following chemically synthesized siRNA oligo (kind gift from Cenix
Bioscience): sense oligo, 5’-CUUACGCUGAGUACUUCGA-dTdT; antisense oligo, 5’-
UCGAAGUACUCAGCGUAAG-dTdT. Two days before transfection of siRNA oligo for
firefly luciferase, INS-1 cells were co-transfected by electroporation (Amaxa) with pGL3Basic and phRL vectors for co-expression of firefly and renilla luciferase, respectively.
Insulin content was measured by RIA, while the other proteins were quantified by
immunoblotting and normalized against -tubulin. The results shown are from six (siRNA
oligos 1+2 for PTB or control scrambled siRNA oligos) or four (siRNA oligo for firefly
luciferase) independent experiments. d, Western blotting for the ER markers calnexin
and PDI in INS-1 cells incubated with resting (R) or stimulating (S) buffer for 120 min.
Unlike most SG proteins, calnexin and PDI are not up-regulated by glucose stimulation,
despite the presence of a consensus motif for PTB binding in their mRNA 3’-UTR. Equal
loading of proteins was verified by western blotting for -tubulin.
e, Immunofluorescence for PTB (red), insulin (green) and ICA512 (red) in INS-1 cells
untransfected or transfected with siRNA oligos 3 or 4. Nuclei were counterstained in blue
with DAPI.
Figure S3 RT-PCR for PTB on 1µg total RNA from INS-1 cells, rat islets and Jurkat
cells. In the case of INS-1 cells and rat islets RNA templates were obtained from cells
kept at rest or glucose-stimulated for the indicated times. For PCR the following specific
primers flanking the entire open reading frame of rat PTB were used: forward, 5’ATGGACGGCATCGTCCCAG; reverse, 5’-CTAGATGGTGGACTTGGAAAAG.
Annealing temperature: 55 °C; amplification: 32 cycles. The 1592 bp cDNA encoding the
57 kD PTB isoform was readily amplified from INS-1 cell and islet RNA, whereas no
shorter PTB variants, including the 700 bp cDNA corresponding to PTB-T, were
detected. However, the 700 bp cDNA for PTB-T could be amplified in the same
conditions from Jurkat cells, which instead expressed almost no mRNA for the full-length
PTB. This expression pattern of PTB in Jurkat cells is comparable to that shown in Fig.
3B in ref. 17. These results indicate that both resting and 120 min. stimulated INS-1 and
islet cells do not express PTB-T.