Problem set 5 Nucleic acids and Protein synthesis 1. Draw the Haworth projection of β-D-ribose and number the carbons. Draw the structure of Adenine and numer the atoms. Connect the ribosome to adenine to make a nucleoside. What carn bon in the sugar is connected to the base? What is the name of the bond?Add the phosphate to make a nucleotide. What carbon in sugar is connected to the phosphate? What is the name of the bond? 2. Constract the nucleic acid that is represented as C T A G. Draw the structure of the entire molecule. Use the letter abbreviations for the bases. Label the 5’ end and the 3’ end of the nucleic acid. Circle the backbone of the polynucleotide. What is(are) the secondary product(s)? You have constructed DNA or RNA? Why? 3. What are the differences between DNA and RNA (four differences)? 4. What is the primary and secondary structure of DNA? What constitutes the backbone of DNA? Dr. Behrang Madani Chemistry 203 CSUB 5. What are the different types of RNA? Explain their functions. 6. The sequence of a short DNA segment is ATGGCAATAC. a) What name do we give to the two ends (terminals) of a DNA molecule? b) In this segment, which end is which? c) What would be the sequence of the complementary strand? 7. Explain the functions of DNA in our body (two functions). 8. Consider the following segment of DNA: ATGAATCGCGATTCATGAGCCATGGTA TACTTAGCGCTAAGTACTCGGTACCAT Label the 5’ and 3’ ends of the strand. Use the different colors to draw the process of replication of the DNA. Label the 5’and 3’ ends in the products. 9. In question 7, identify which strand to use for transcription. Describe where and how mRNA is transcribed. Use two different colors to draw the process of transcription. Label the 5’ and 3’ ends in the product. Dr. Behrang Madani Chemistry 203 CSUB 10. In question 8, describe where and how the mRNA is translated into protein. Use four different colors to draw the process of translation, one for each of the types of RNA and another color for the protein chain. Circle the codons. Write the sequence of the anticodons in the correct place. Label the 5’ and 3’ ends. Label the N and C terminals. 11. In question 7, if the base #5 is mutated from A to G, describe the effect on the protein chain. T C 12. In question 7, if the base pair #10 is missing, describe the effect on the protein chain. 13. The following portion of DNA is in the template DNA strand: -GCT-TTT-CAA-AAAa) What is the corresponding mRNA section? b) What are the anticodons of tRNAs? c) What amino acids will be placed in the peptide chain? Dr. Behrang Madani Chemistry 203 CSUB