SUPPLEMENTARY METHODS Plasmid constructs and Adenoviruses. LacZ from pcDNA3.1/His/LacZ (Invitrogem) was amplified with Platinum pfx DNA polymerase (Invitrogen) using a 5’ primer flanked with 3’ end of F2A fragment (5’CTTTGAATTTTGACCTTCTCAAGTTGGCCGGAGACGTCGAGTCCA ACCCCGGGCCTATGGACCCCGTCGTTTTACAAC-3’) and a 3’ primer flanked with part of the shuttle vector pShuttleX (5’GTTTAAACTTAAGCTTGGTACAATTCTTATTTTTGACAC CAGACCAACTGGTAA-3’). The PCR product was subcloned into pCR4Blunt-TOPO vector (Invitrogen) and sequenced at Lone Star Labs Inc. (Houston, TX). The resulting partial-F2A-LacZ-pshuttlex fragment in pCRBluntII-TOPO was amplified again using a 5’ primer flanked with 3’ end of iMC, previously described (13), an HA-tag, and the remaining 5’ end of the F2A (5’CCGGAGTCGACTATCCGTACGACGTACCAGACTACGCACTCGACGTGAAA CAGACTTTGAATT TTGACCTTCTCAAGTTG-3’) and a 3’ primer flanked with 5’ partial LacZ with a ClaI site (5’-CCACGCTCATCGATAATTTCACCG-3’). This PCR fragment was cloned into the pCR4Blunt-TOPO vector and sequenced by Lone Star Labs Inc. This fragment was then excised with BamHI (New England Biolabs, Ipswich, MA) and ClaI (Invitrogen) and subcloned into similarly digested pCR4Blunt-TOPO vector containing the partial-F2A-LacZ-pShuttlex fragment described above to make partialiMC-HA-F2A-LacZ-partialpShuttleX. Next we excised this fragment with SalI (New England Biolabs) and AflII (New England Biolabs) and subcloned it into the similarly digested pShuttleX-iMC plasmid, previously described (13), to make pShuttleX-iMC-HA-F2A-LacZ (also known as bicistronic vector or bv). pShuttle gene cassettes were subcloned into the Adeno-X expression system (BD Biosciences) to create E1, E3-deleted, replication-incompetent Ad5 adenoviruses as previously described (11). Production, purification, and large-scale expansion as well as titration of adenovirus were carried out by the Vector Development Laboratory Core at Baylor College of Medicine. Ad5 adenovirus expressing no transgene (Ad-Empty), EGFP (Ad-EGFP), dsRED (Ad-dsRED) and LacZ (Ad-LacZ) were purchased from the Vector Development Laboratory Core at Baylor College of Medicine.