Finding Genes With Similar Sequences
(Blast Search)
1. Open your Web Browser such as Internet Explorer and type in the following address
http://www.ncbi.nih.gov/
2. From the above website choose BLAST which is in the toolbar above the search box.
3. You will then need to choose the appropriate databases to search depending on what type of
DNA you have sequenced. (ie, genomic, translated proteins, etc) If you are searching using a
nucleotide sequence choose “nucleotide-nucleotide (blastn)”
4. Once you have chosen your database you will be given search options.
5. Copy your DNA sequence and Paste it into the Search box.
For an example copy the following code and paste it into the search box:
gtcaactgggctccattcattctttccatttctctaacacgtgccaggtggtctcatctccgggcctttgcccttgctgtt
ccctgtcatcattcaggtctcacttgtcatttcctgaccatggtacttataaaagcagtgccgtctgccccatccatgtca
cctcgttcatctccttcacctccgaaatgatctcgcttttgggtttacggccggtctcttcacctggagcatcagccgggg
aggtcagggtcccctggctcgggcctgttcacattggggtcaaaggcacacattgggggctcaaccaaggcgagctcgttc
gcggggccgggtctttccgcacaggcggagggcggtggcgggcgcggaggcgtcgcgcgagccagggggcacgcacgggcc
gggggtacctagcgccacccgcttcgcttgcatcagctgcgcgccccatcccgaggaatggtagaggcagccccgcccccg
gcccgcccccgcctttccattggctgccgcgcggggcggggagcggggtcggctcagtggccctgagaccctagctctgct
ctcggtccgctcgctgtccgctagcccgctgcgatgttgcgcgctgccgcccgcttcgggccccgcctgggccgccgcctc
ttgtcagccgccgccacccaggccgtgcctgcccccaaccagcagcccgaggtcttctgcaaccaggtgcgta
6. Choose your appropriate database (nr will search all databases)
7. Hit BLAST!
8. Your search is put into a queue and estimated time is given for the completed search.
9. Hit Format! to see your results
10. A list of results will be given with a score and E value to show how close your sequence was
to the blast results. Small E values indicate a close match, 0 indicates 100% match.
11. Click on the link of your results for a detailed description.
12. Find the full name of the gene and its code. In this example the gene is the “Human nucleusencoded mitochondrial aldehyde dehydrogenase 2gene” and the code is “ALDH2”.
Finding A Gene In The Human Genome
1. Return the www.ncbi.nlm.nih.gov homepage and follow the Map Viewer option under the
Hot Spots. This will lead you tohttp://www.ncbi.nlm.nih.gov/mapview/
2. Either select your organism of choice (for this example homo sapiens) from the search pull
down menu or click on the name of the organism in the phylogenetic tree. If you are looking
for a specific gene you can type the name of it in the search box to the right of the pull down
menu (from blast: ALDH2).
3. Hit Go.
4. A red line will appear next to the chromosome wherever a gene matching your search can be
found. Below that is a list of search results. Click on the link next to the gene to see more
information. (If given a choice of 2 or more genes that appear to be similar choose the gene
that has “Gene” under type not “MIM”.)
5.
6.
7.
A map of the region of the chromosome with that gene will appear. The gene you are
interested in will be highlighted. On the left is a diagram of the entire chromosome that
indicates where your gene is.
Use the menu on the left to zoom in and out. Zoom in to see the genes immediately next to
your gene. The scale immediately to the left of your gene indicates placement on the
chromosome. For example ALDH2 is located on chromosome 12 from approximately
110,610Kbp to 110,660Kbp.
To the right of your gene is a short description of what the gene does. For a more detailed
description click on the symbol of your gene.