Appendix: Genetic Diversity of Newly Diagnosed Follicular Lymphoma Asmann, YW et al METHODS Patients and tissue samples: Patients with FL were diagnosed and classified according to World Health Organization criteria. The fresh frozen tumors and paired peripheral blood (referred to as “normal”) samples were obtained from the Mayo Lymphoma Molecular Epidemiology Resources (MER). The characteristics of the 8 FL patients are listed in Table 1 in the main text. Exome sequencing of these 8 FL tumor-normal pairs were performed at the Mayo Clinic Advanced Genomics Technology Center. The coding regions of the genome were captured using SureSelect Target Enrichment System version 2.0 (Agilent; Santa Clara, CA) which targets ~36 Mb of coding exons, and 100-bp paired-end sequencings were carried out on an Illumina HiSeq 2000 sequencer. The wholegenome mate-pair libraries of both normal and tumor samples with 5kb insert sizes were sequenced paired end at 50-bp read length on the Illumina HiSeq 2000. For RNA sequencing of 8 FL tumors, total RNA was extracted using Exiqon’s miRCURY RNA Isolation Kit, and mRNA was purified and the sequencing libraries were constructed according to Illumina TruSeq protocol. The sizes of the library fragments selected for sequencing were between 150-250 bp, and 50 bp paired-end sequencing was performed. Exome Sequencing and Variant Calling: The qualities of the raw sequence reads were checked by FastQC (http://seqanswers.com/wiki/FastQC), and the paired-end reads were aligned to Human Reference Genome Build 37 using BWA [1] and local-realigned and re-calibrated using GATK [2]. Using the TREAT analytic work flow [3], the single nucleotide variants (SNV) and small insertions and deletions (INDEL) were called using SNVMix [4] and GATK, respectively. The identified variants were annotated using both Seattle-Seq (http://snp.gs.washington.edu/SeattleSeqAnnotation134/) and SIFT [5]. For the current study, we only included the following variants in our analyses: (i) frame-shift and splice-site INDELs; (2) non-sense and splice-site SNVs; and (3) non-synonymous or missense SNVs. The tumor-specific or somatic variants (INDELs and SNVs) were identified as described below. First, we required minimum sequencing depth of 8 reads at each variant site in both tumor and normal samples. The INDELs must be supported by at least 3 reads and present in only tumor but not paired normal sample. The somatic SNVs were defined as Chi-Square test p value ≤ 0.01 at variant site using read depth values of tumor and normal, and the numbers of reads supporting alternative alleles in tumor and paired normal samples. In addition, we also filtered out polymorphic positions with variant allele frequencies (VAF) > 0.01 in the 5500 subjects of the Exome Project (http://exome.gs.washington.edu/) or with Miner Allele Frequency (MAF) > 0.05 in dbSNP version 134. RT-PCR and Sanger Sequencing Validation of Somatic CRIPAK Mutations: The frozen tumors of 20 FL and 31DLBCL were obtained from Mayo Specialized Program of Research Excellence (SPORE) Molecular Epidemiology Resource. The total RNAs were extracted from the tissues using the QIAGEN RNA Easy Mini Kit, and were reverse transcribed into cDNA. The exon (the only exon of 1341 nt) plus 250 bp of the 5’ UTR and 50 bp of the 3’-UTR regions of the CRIPAK gene were amplified using polymerase chain reaction (PCR) (forward primer: 5’ GGGCATCTCGTTCCTCAGAT 3’; and reverse primer 5’ AGCACCAGGCTAACAAATCAGTCC 3’). The PCR amplified cDNA were sequenced using Sanger technology. Regulatory Network Analysis of Frequently Mutated Genes in NHL: Regulatory network analysis of multiple genes was performed using the shortest path algorithm from MetaCore (GeneGo Inc.) and the gene-gene relationships annotated in the MetaCore Knowledge Database (6.11 build 41105). The network statistics and the hub genes of the network was calculated and the hub genes are defined as the network nodes with the number of connections (or edges) large than 25% of the total nodes in the network. Protein-Protein Interaction Distance: Protein-protein interaction (PPI) relationships are retrieved from Human protein reference database (HPRD) [6]. The pair-wise shortest distance in retrieved PPI network was defined as average of shortest distance between two proteins in a given protein set G with N proteins, and was computed as: s 2 d PPI ( g1, g2 ) . N ( N 1) g1 ,g2G To construct a null model assessing how the actually computed statistics s differs from random cases, we sampled 10,000 random protein sets {GnRand }n1, {snRand }n1, ,1e 4 ,1e 4 of N proteins and computed corresponding values of , and compared the s of the actual G with the distribution of the s values from random samplings. RNA-Seq Data Analysis and Fusion Transcript Detection: The mRNA expression of the genes were calculated using HTSeq (http://seqanswers.com/wiki/HTSeq) after BWA alignment of the paired-end reads to both reference genome (Build 37) and exon junctions. The fusion transcripts and isoforms were identified using the SnowShoes-FTD algorithm [7]. We required that the two fusion partner genes be on different chromosomes or at least 50,000 bp apart if on the same chromosome, and that a fusion transcript is supported by at least 3 pairs of encompassing reads and 2 unique fusion junction spanning reads. In addition, we allowed up to ten isoforms between two fusion partners. Detection of Somatic Copy Number Variants in FL Tumor: The exon level copy number variants (CNV) were detected in paired tumor-normal exome sequencing data using the in-house developed algorithm, PatternCNV, which is based on the observation that in exome sequencing data the distribution of the mapped reads, although not uniform among different exons within a sample, are consistent for each exon across different samples when there is no CNV events in the region [8]. In addition, the genome-level CNVs were identified from the paired tumor-normal mate-pair DNA sequencing data using an extended version of PatternCNV. Detection of Somatic Copy Neutral Structural Variants: The large structural variants including the copy neutral structural variants (SV) such as translocations and inversions were detected in paired tumor-normal whole genome mate-pair DNA sequencing data using an in- house developed algorithm, SnowShoes-SV (Asmann, et al manuscript submitted), which is based on the disconcordant mapping of the read-pairs. The SnowShoes-SV is an exhaustive algorithm for SV detection and the false positives were filtered out using both paired normal samples and a pool of Mayo Biobank control subjects, as well as the alignment features of the potential SV regions. RESULTS Sequencing Statistics: The exomes of 8 tumor-normal pairs of FL samples were sequenced at depths of 107-164 million 100-bp paired-end reads per sample with ~45% of the reads on target, which led to ≥10-fold coverage in 90% of the targeted regions in all samples. The tumor and paired normal mate-pair libraries were sequenced at 127-206 million 50-bp paired end reads with 58-62% reads mapped to genome. The eight tumor RNA samples were sequenced at depths of 136-186 million 50-bp paired-end reads per sample with 58-64% reads mapped to known genes and exon junctions. The Diversity of Mutational Landscape in FL: The 8 FL patients were clinically diverse (Table 1, main text), including four grade 1-2 indolent tumors, classified as indolent tumors; and two grade 3A tumors plus two grade 1-2 tumor subsequently transformed, classified as aggressive tumors. Two of the patients did not receive initial treatments after diagnosis (observations only), and three patients are event-free after 46, 79, and 100 months while two patients had subsequent transformation of their tumors. Interestingly, the two grade III FL tumors from patient #7 and #8, harbor the most genomic abnormality with: (i) highest number of genes with point mutations (SNVs and short INDELs, Figure 1b middle panel, and Supplement File S1); (ii) highest number of genes impacted by copy number aberrations (Figure 1b upper panel, and Supplement File S2); and (iii) substantially higher number of large structural variants compared to the other six tumors (Figure 1b lower panel, and Supplement Files S3, S7). The genomic diversity of these tumors appeared to parallel the clinical diversity of the patients. As shown in Figure 1c and Supplement Files S3 and S7, we identified several recurrent mutations including the well characterized t(14;18) translocation in 1 of the 2 grade 3A tumors and 5 of 6 grade 1-2 patients. A chr1q amplification was observed in 4 out of 8 samples (Figure 1a and 1c; and Supplement Files S3, S7). In addition, recurrent point mutations were found in previously reported lymphoma genes. The histone methyltransferase gene MLL2 gene was mutated in 3 out of 8 patients; and the histone acetylation gene CREBBP was mutated in 2 out of 8 patients. The Histone cluster genes and HLA genes were also mutated in 2 and 3 out of 8 cases, respectively. In addition, we identified recurrent point mutations in a histone methyltransferase gene (CRIPAK, cysteine-rich PAK1 inhibitor), and copy number deletions of a tumor suppressor gene (DMBT1, deleted in malignant brain tumors 1) in 2 cases (Supplement File S2). The mutational landscape of individual tumors will be discussed in detail below. Patient Description and Observed Genomic Alterations: Patient #1: this female patient was diagnosed at age 56 with a grade 1 stage III follicular lymphoma. She has received no treatment before and after surgery/biopsy and has been treatment-free for 100 months. The tumor from this patient had the t(14;18) translocation and had a frame-shifting short insertion mutation in MLL2, a missense mutation in BCL2, a missense mutation in the histone H2A family gene HIST1H2AM, and deletion of the tumor suppressor gene DMBT1. This tumor had a chr7 trisomy. Patient #2: this male patient was diagnosed with grade 2 Stage III FL at a young age of 39. He was enrolled in RESORT trial as initial treatment and later received maintenance R therapy. So far, the patient has been event free for 79 months. This tumor carried the t(14;18) translocation. A nonsense mutation was observed in the TNFRSF14 gene, as well as two frame-shifting INDELs in the HLA-B gene. This patient also had a frameshifting small deletion in the CRIPAK gene. Patient #3: this male patient was diagnosed with a grade 2 and stage III FL at age 56. The patient was placed under observation without treatment initially and went on to receive rituximab monotherapy 8 months after diagnosis. The patient subsequently entered a vaccine trial and later was managed with rituximab monotherapy. This tumor had the t(14;18) translocation. However, we did not observe mutations in known lymphoma genes. Patient #4: this male patient was diagnosed at age 55 with a grade 2, stage II FL and received R-CHOP as initial treatment due to tumor related small bowl obstruction. The patient had an asymptomatic FL II relapse 68 months from diagnosis and subsequently enrolled in an Ibrutinib trial. The noticeable mutations in this tumor were the t(14;18) translocation, the DMBT1 deletion, and MYC amplification. This tumor had a chr8 trisomy. Patient #5: this female patient was diagnosed at age 52 with a grade 1 stage III tumor. She received the initial R-CVP treatment which was ineffective. A re-biopsy after cycle one showed DLBCL and the patient was subsequently treated with R-CHOP, then R-ICE and an autologous stem-cell transplant. This tumor had the t(14;18) translocation as well as the chr1q amplification. We also identified a frame-shifting small deletion in MLL2, a missense mutation in CREBBP, a nonsense mutation in the histone H2B family gene HIST1H2BD, and one frame-shifting and two missense mutations in CRIPAK gene. In addition, a missense mutation was observed in TBL1XR1 (Transducin Beta-Like 1 X-Linked Receptor 1) gene which has been reported to be mutated in the primary central nervous system lymphoma [9] and was involved in the TBL1XR1/TP63 fusion in FL, DLBCL, and T-cell lymphoma [10] [11]. This sample had a chr12 trisomy as well as the chr1q amplification. Patient #6: his male patient was diagnosed with grade 2stage III FL at age 66 and was initially treated with CVP. The patient relapsed after 16 months. The patient subsequently had 6 additional regimens, including RCHOP and autologous stem cell transplant. In addition, the tumor transformed at relapse to FL 3A and later FL3B. This is the only non-grade-III tumor without the t(14;18) translocation. However the tumor does have the chr1q amplification in addition to chr18 and chr21 trisomy. We did not detect point mutations in genes known to be mutated in lymphoma. Interestingly multiple fusion transcripts were identified in this tumor (Supplement File S5, and Supplement File S6 Figure B): C17orf68 NXN, LOC100132273 CCDC117, and TFG GPR128. The NXN (nucleoredoxin) as a fusion partner gene is interesting since it is a redox-dependent negative regulator of the Wnt signaling pathway [12]. The TFG GPR128 fusion is a known germline fusion previously detected in both lymphoma and healthy subjects [13], and our tumor-normal paired DNA mate-pair sequencing data also support it as a germline DNA fusion. The TFG GPR128 fusion is also the only recurrent fusion after screening the public RNA-Seq data of 12 FL and 92 DLBCL tumors (dbGAP study accession number: phs000235.v3.p1) [14, 15]. Patient #7: this male patient was diagnosed with grade 3a stage III/ FL at age 41 as was treated on the lenalidomide/R-CHOP clinical trial. This patient remains event-free at 46 months. This is one of the two grade III tumors profiled and had the second highest number of point mutations, CNA, and structural variants. It had the t(14;18) translocation, the chr1q amplification, and chr13/chr15/chr17 deletions. There were frame-shifting INDELs observed in CREBBP and HLA-DRB1 genes. This tumor also has a NOTCH2 gene deletion. We detected two fusion transcripts from the transcriptome sequencing data (Supplement File S5, and Supplement File S6 Figure B): AK7 CBL and VCPIP1 MYBL1. The partner genes involved in these two fusions are intriguing. The CBL oncogene (Casitas B-lineage lymphoma proto-oncogene) is an E3 ubiquitin-protein ligase which has been shown to induce mouse pre-B and pro-B cell lymphomas [16], and the MYBL1 gene (v-myb myeloblastosis viral oncogene homolog (avian)-like 1) is a strong transcription activator and might have a role in the proliferation and/or differentiation of B-lymphoid cells [17]. Patient #8: this male patient was diagnosed with grade 3A and stage III FL at age 54 and received RCHOP initially. The FL relapsed after 35 months and the patient subsequently was treated with R monotherapy. This tumor does not harbor the common t(14;18) translocation but had instead large number of other structural variants. The chr1q of this tumor was amplified, and the chr1p had both amplifications and deletions. The chr1 abnormality also resulted in high number of large SVs with and without inversions. Furthermore, the chr17 had the p arm deletion and q arm amplification. In addition to the large number of structural variants, this stage III tumor also had the highest number of both point mutations and CNAs among 8 FL tumors profiled. The observed point mutations include a frame-shifting small deletion in MLL2, a missense mutation in TP53, frameshifting INDELs in both HLA-B and HLA-DRB1, and a nonsense mutation in FAS (Fas cell surface death receptor) gene which was previously reported in lymphoma [18] [19]. It’s worth noting that one copy of the TP53 in this tumor was deleted and the remaining copy had the missense mutation. We also detected an expressed fusion gene (Supplement File S5, and Supplement File S6 Figure B), MAP4GNL3, in the RNA-Seq data from this tumor. The fusion gene partner, GNL3 (guanine nucleotide binding protein-like 3) is known to interact with TP53 and MDM2 [20] and may play an important role in tumorigenesis. Identification of CRIPAK mutations in FL and DLBCL: The mutation of CRIPAK, the cysteine-rich PAK1 inhibitor, has not been reported previously. Although it was mutated in only 2 out of 8 FL tumors studied, this supports the important role of histone modification genes in lymphoma tumorigenesis. CRIPAK is a negative regulator of PAK1, and the only known/reported connection of CRIPAK with tumor is that the loss of CRIPAK in breast cancer has been suggested to contribute to hormonal independence [21]. A bioinformatics analysis showed that the coding regions of CRIPAK are highly enriched with the protein functional domain post-SET according to ENSEMBL (http://useast.ensembl.org/Homo_sapiens/Gene/Summary?db=core;g=ENSG00000179979;r=4:13853401389780;t=ENST00000324803). The post-SET domain is usually found in a number of histone lysine methyltransferases (HMTase), C-terminal to the SET domain which is a conserved 130 amino acid sequence known to methylate histones on lysine [22]. We performed RT-PCR and cDNA Sanger sequencing and observed CRIPAK mutations in 11 out of 20 (55%) FL and 12 out of 31 (38.7%) DLBCL tumors. Additional validation was done by analyzing the publicly available RNA sequencing data of 12 FL and 71 DLBCL tumors where CRIPAK mutations were identified in 3 FL (25%) and 17 DLBCL (23.9%) cases. Note that the sequencing depth of CRIPAK in the RNA-Seq data varied and we only examined the regions with sufficient number of read coverage. The relationships between CRIPAK and other mutated genes in FL and DLBCL: Since genes with related biological functions often interact with each other in the context of pathways and gene sets, we hypothesized that CRIPAK is functionally close to the previously identified genes recurrently mutated in FL and DLBCL. We collected a list of 29 genes from published literature (Supplement File S4, worksheet “Seed Genes”), and performed regulatory network analyses of these genes using the shortest path algorithm available in MetaCore (GeneGo Inc.). Note that we had to exclude one of the 29 genes, TMSL3, because it is a pseudogene and was not recognized by MetaCore. As shown in Figure 2b, there are 31 nodes included in the network, and 24 out of 28 (86%) genes known to be mutated in FL and/or DLBCL are connected with each other around 8 hub genes: MYC (25 edges), TP53 (18 edges), EP300 (17 edges), BCL6 (14 edges), ESR1 (12 edges), EZH2 (11 edges), BCL2 (9 edges), and STAT6 (9 edges). In the context of this manuscript, we refer to these 31 node genes as the “FL/DLBCL mutation network genes”. CRIPAK was placed in the network only one node away from one of the hub genes ESR1 (estrogen receptor 1). Other genes that are connected to the ESR1 hub are MLL2, EP300, CREBBP, SGK1, BCL2, MYC, EZH2, TP53, and PRDM1. We tested the significance of the connectivity between these 31 network node genes using the PPI database. The PPI network consists of 9,300 proteins with 35,000 documented interactions. We performed 10,000 simulations and each time 31 random proteins were selected to calculate the average pair-wise shortest distance (the s value). As shown in Supplement File S6 Figure A, the average pair-wise distance of the 31 “FL/DLBCL mutation network genes” is smaller than any single s values obtained from our random sampling (empirical p value = 0 from 10,000 simulations). Therefore the proximity of the “FL/DLBCL mutation network genes” was statistically significant. REFERENCES 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. Li, H. and R. Durbin, Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics, 2009. 25(14): p. 1754-60. McKenna, A., et al., The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome research, 2010. 20(9): p. 1297-303. Asmann, Y.W., et al., TREAT: a bioinformatics tool for variant annotations and visualizations in targeted and exome sequencing data. Bioinformatics, 2012. 28(2): p. 277-8. Goya, R., et al., SNVMix: predicting single nucleotide variants from next-generation sequencing of tumors. Bioinformatics, 2010. 26(6): p. 730-6. Kumar, P., S. Henikoff, and P.C. Ng, Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm. Nat Protoc, 2009. 4(7): p. 1073-81. Keshava Prasad, T.S., et al., Human Protein Reference Database--2009 update. Nucleic acids research, 2009. 37(Database issue): p. D767-72. Asmann, Y.W., et al., A novel bioinformatics pipeline for identification and characterization of fusion transcripts in breast cancer and normal cell lines. Nucleic acids research, 2011. 39(15): p. e100. Wang, C., et al., PatternCNV: a versatile tool for detecting copy number changes from exome sequencing data. Bioinformatics, 2014. Gonzalez-Aguilar, A., et al., Recurrent mutations of MYD88 and TBL1XR1 in primary central nervous system lymphomas. Clinical cancer research : an official journal of the American Association for Cancer Research, 2012. 18(19): p. 5203-11. Scott, D.W., et al., TBL1XR1/TP63: a novel recurrent gene fusion in B-cell non-Hodgkin lymphoma. Blood, 2012. 119(21): p. 4949-52. Vasmatzis, G., et al., Genome-wide analysis reveals recurrent structural abnormalities of TP63 and other p53related genes in peripheral T-cell lymphomas. Blood, 2012. 120(11): p. 2280-9. Funato, Y. and H. Miki, Redox regulation of Wnt signalling via nucleoredoxin. Free radical research, 2010. 44(4): p. 379-88. Chase, A., et al., TFG, a target of chromosome translocations in lymphoma and soft tissue tumors, fuses to GPR128 in healthy individuals. Haematologica, 2010. 95(1): p. 20-6. Morin, R.D., et al., Somatic mutations altering EZH2 (Tyr641) in follicular and diffuse large B-cell lymphomas of germinal-center origin. Nature genetics, 2010. 42(2): p. 181-5. Morin, R.D., et al., Frequent mutation of histone-modifying genes in non-Hodgkin lymphoma. Nature, 2011. 476(7360): p. 298-303. Langdon, W.Y., et al., v-cbl, an oncogene from a dual-recombinant murine retrovirus that induces early B-lineage lymphomas. Proceedings of the National Academy of Sciences of the United States of America, 1989. 86(4): p. 1168-72. Trauth, K., et al., Mouse A-myb encodes a trans-activator and is expressed in mitotically active cells of the developing central nervous system, adult testis and B lymphocytes. The EMBO journal, 1994. 13(24): p. 59946005. Gronbaek, K., et al., Somatic Fas mutations in non-Hodgkin's lymphoma: association with extranodal disease and autoimmunity. Blood, 1998. 92(9): p. 3018-24. Takakuwa, T., et al., Frequent mutations of Fas gene in nasal NK/T cell lymphoma. Oncogene, 2002. 21(30): p. 4702-5. Dai, M.S., X.X. Sun, and H. Lu, Aberrant expression of nucleostemin activates p53 and induces cell cycle arrest via inhibition of MDM2. Molecular and cellular biology, 2008. 28(13): p. 4365-76. Talukder, A.H., Q. Meng, and R. Kumar, CRIPak, a novel endogenous Pak1 inhibitor. Oncogene, 2006. 25(9): p. 1311-9. Dillon, S.C., et al., The SET-domain protein superfamily: protein lysine methyltransferases. Genome biology, 2005. 6(8): p. 227.