Domain-level identification and quantification of relative prokaryotic cell abundance in microbial
communities by Micro-FTIR spectroscopy
M. Igisu, K. Takai, Y. Ueno, M. Nishizawa, T. Nunoura, M. Hirai, M. Kaneko, H. Naraoka, M.
Shimojima, K. Hori, S. Nakashima, H. Ohta, S. Maruyama, and Y. Isozaki
Supporting information
Materials and methods
Representative bacterial, archaeal and eukaryotic cultures and preparation of micro
FTIR spectroscopy specimens
Bacterial and archaeal strains used in this study are indicated in Figure 1. Most of
the bacterial and archaeal species and strains are originally isolated by SUGAR project,
JAMSTEC, from various extreme environments. Methanopyrus kandleri strain 122
(Takai et al., 2008), Methanotorris formicicum (Takai et al., 2004a), Thermococcus
stetteri strain Tc-1-95 (Takai et al., 2004b), Aeropyrum camini (Nakagawa et al., 2004),
Persephonella hydrogeniphila (Nakagawa et al., 2003), Deferribacter desulfuricans
(Takai et al., 2003), Hydrogenimonas thermophila (Takai et al., 2004c) and
Thiomicrospira thermophila (Takai et al., 2004d) were isolated from deep-sea
hydrothermal environments. Clostridium sp. was isolated from subseafloor sediments
off the Shimokita, Japan (Kobayashi et al., 2008). Methylothermus subterraneus. was
isolated from a Japanese subsurface gold mine aquifer (Hirayama et al., 2010).
Sulfurivirga caldicuralii was isolated from a coastal coral reaf hydrothermal
environments off Taketomi Island (Takai et al., 2006). Methanocella paludicola was
isolated from a Japanese rice paddy soil (Sakai et al., 2008). Thermoplasma
acidophilus,
Thermococcus
kodakaraensis,
Acidianus
brierleyi,
Sulfolobus
acidocaldarius, Streptococcus albus, Bacillus subtilis, Saccharomyces cerevisiae and
Aspergillus versicolor were originally purchased from Japan Collection of
Microorganisms (JCM). Escherichia coli strain INV-α was purchased by Invitrogen
Japan (Tokyo). Haloarcula japonica, Synechocystis sp. PCC6803, Gloeobacter
violaceus PCC7421, Chlamydomonas reinhadii and Klebsormidium flaccidum were
obtained from Tokyo Institute of Technology.
All the bacterial, archaeal and eukaryotic species and strains were cultivated with
the optimal media under optimal conditions. The late exponential growth phase of
culture was harvested by centrifugation at 4 ˚C under air atmosphere. The harvested
cells were rinsed with deionized distilled water (DDW) for freshwater microorganisms
or with DDW containing 3% (w/v) NaCl for marine microorganisms and centrifuged.
This procedure was repeated three times. Finally, cell pellets were picked up by a
micropipet to place on a CaF2 disk and then were completely dried up (untreated cells).
The cell pellets of some bacterial, archaeal and eukaryotic species and strains
were chemically fixed by fresh media containing 5% (w/v) paraformaldehyde at 4 ˚C
overnight. The fixed cells were washed several times with DDW or with DDW
containing a serial dilution of NaCl concentrations (3, 1.5, 0.8, 0.4 and 0%). The
washed pellets were then rinsed with DDW containing 1 N HCl twice and were then
washed again with DDW twice. The pellets were placed on the CaF2 disks and then
were completely dried up (fixed cells). In addition, before mounting on the CaF2 disks,
some of the pellets were stained with DDW containing 4', 6-diamidino-2-phenylindole
(DAPI) (10 µg/ml). After staining with DAPI, the cells were washed with DDW twice,
placed on the CaF2 disks and dried (stained cell).
Extraction of lipids and preparation of micro FTIR spectroscopy specimens
From some of the bacterial, archaeal and eukaryotic species and strains, total lipid
was extracted according to the method by Nishihara and Koga (1987). The lyophilized
cells (0.1-0.2 g dry weight) were dissolved with 2850 µl of trichloroacetic acid solvent
(TCA-acid solvent) containing 300 µl of DDW, 300 µl of 10% aqueous TCA, 1500 µl
of methanol and 750 µl of chloroform and stirred with 0.2 mm glass beads at room
temperature over night. Then, additional 750 µl each of DDW and chloroform was
added to the mixture. After separation into two phases by low-speed centrifugation, the
lower chloroform phase was washed with a 1.9 volume of methanol-water (1 : 0.8)
several times to remove TCA. Finally, the total lipids were concentrated by drying
solvent, dissolved with 200 µl of chloroform-methanol (2 : 1) and mount on the CaF2
disks.
Phylogenetic tree of representative bacterial and archaeal species and strains
The nearly complete sequences of 16S rRNA genes of representative bacterial and
archaeal species and strains were manually realigned according to the secondary
structures using ARB (Ludwig et al., 2004). Phylogenetic analyses were restricted to
unambiguously aligned nucleotide positions. Maximum likelihood analysis was
performed using TREE-PUZZLE package (Schmidt et al., 2002).
Sampling of a naturally occurring microbial community
Microbial community was sampled from a subsurface geothermal aquifer stream
in a Japanese gold mine (Takai et al., 2002; Inagaki et al., 2003; Hirayama et al., 2005).
The microbial community consisted of thermophilic, dense microbial filaments
occurring at 65 ˚C and at pH 7.5, which was similar with the microbial mat at the
middle stream described by Hirayama et al. (2005). The microbial filaments were
sampled by a sterilized plastic syringe. A portion of the microbial filaments was
concentrated with a disposable 0.22 µm-pore-sized filter. The filtrated materials were
immediately frozen for the subsequent DNA extraction and intact polar lipid extractions.
Another portion was immediately fixed by addition of paraformaldehyde at a final
concentration of 5% (w/v) for over night and was then preserved at -80 ˚C for the FISH
and micro FTIR analyses.
Extraction and quantification of bacterial and archaeal intact polar lipids
The microbial filament sample was freeze-dried and powdered prior to the lipid
extraction. Total lipids were extracted using the Bligh and Dyer method (Pitcher et al.,
2009).
The
lipids
were
ultrasonically
extracted
using
a
methanol
(MeOH)/dichloromethane (DCM)/phosphate buffer (PB) (2/1/0.8, v/v/v) three times for
10 min. After the solvent was centrifuged, the supernatant of each extraction was
combined. Into the supernatant, DCM and PB were added at a final MeOH/DCM/PB
ratio of 1/1/0.9 (v/v/v). The DCM phase was recovered and concentrated using a rotary
evaporator. The extract was dried over a Na2SO4 column. Intact polar lipids (IPLs) in
the extract were separated by silica gel column chromatography with 10 ml of methanol
as an eluent after non-polar lipids were removed with 3ml of hexane/ethyl acetate (3/2,
v/v). The chromatographic separation was modified after Oba et al. (2006) and Pitcher
et al. (2009) and was confirmed using an IPL standard (Matreya, LLC).
An aliquot of methanol fraction was reacted with HI (57%, Wako Chemicals) in
an ampoule purged by N2 at 110ºC for 3h. The reactant was recovered by 2 ml of
hexane three times. The combined solution was concentrated to 2ml under gentle N2
stream. The iodoalkanes were hydrogenated to hydrocarbons by H2 bubbling in the
presence of PtO2 for 30 min.
Another aliquot of methanol fraction was dried under gentle N2 stream. The
residue was saponified with 0.5 M KOH/MeOH (5wt% H2O). After the solvent was
evaporated under gentle N2 stream, a mixture of hexane, diethyl ether and H2O was
added to be a ratio of 9/1/5 (v/v/v), then the neutral compound fraction in organic phase
was removed. The resulting alkaline solution was acidified with 6M HCl to yield free
fatty acids which was recovered with 3ml of hexane/ether (9/1, v/v) three times. After
the solvent was removed, the fatty acid was esterified with ~2 ml of BF3/MeOH in an
ampoule purged by N2 at 90ºC for 1h. After 1ml of H2O was added, the fatty acid
methyl esters (FAMEs) were recovered with 3 ml of hexane. The FAME fraction was
purified by silica gel column chromatography with hexane/DCM (1:2 v/v).
The lipid biomarkers were quantified using an HP 6890 gas chromatograph (GC)
equipped with a flame ionization detector (FID) and a DB-5 fused silica capillary
column (30 m length, 0.25 mm i.d., 0.25 µm film thickness, J & W Scientific) using
helium as a carrier gas at a flow rate of 1.4 ml/min. The GC oven temperature was 50°C
initially, heated at 30°C/min to 140°C, then to 320°C at 5°C/min, and kept at 320°C for
20 min. The concentration was calibrated using n-alkane standards.
Compound
identification
was
performed
by
gas
chromatography/mass
spectrometry (GC/MS) using an HP 6890 GC connected to HP 5972A mass selective
detector (MSD). Compounds were separated by a DB-5MS fused silica capillary
column (30m length, 0.25 mm i.d., 0.25 µm film thickness, J&W Scientific) with
helium as a carrier gas. The samples were injected by splitless injection under a
constant-flow mode. The oven temperature was held at 50°C for 2 min, heated to 140°C
at 30°C/min, then to 320°C at 5°C/min and held constant for 20 min.
Extraction of microbial DNA, quantitative PCR of 16S rRNA gene, and 16S rRNA
gene clone analysis
From the frozen sample consisting of microbial mat formation and rock debris,
the microbial DNA assemblage was extracted by using the Ultra Clean Mega Soil DNA
kit (MO Bio Laboratory, Solana Beach, CA, USA), following the manufacturer’s
instructions. Quantitative PCR of archaeal and entire prokaryotic 16S rRNA genes was
performed using 7500 Real Time PCR System following a method constructed by Takai
& Horikoshi (2000) with minor modifications described previously (Nunoura et al.,
2008). For amplification standards of archaeal and prokaryotic 16S rRNA genes, 16S
rRNA gene mixtures described previously were used (Takai and Horikoshi, 2000).
Prokaryotic 16S rRNA gene clone analysis was conducted with another PCR
experiment. Both bacterial and archaeal genes were amplified from DNA extracts from
the microbial filaments by PCR using LA Taq polymerase with GC buffer (TaKaRa Bio,
Otsu, Japan). The oligonucleotide primers used were various derivatives of previously
designed 530F and 907R primers (Lane, 1985). As the 530F primer mixtures, the primer
sequences
of
GTGCCAGCAGCCGCGG,
GTGBCAGCCGCCGCGG,
YTGCCAGCCGCCGCGG, GTGCCAGCAGCWGCGG, GTGCCAGCAGTCGCGG,
GTGCCAGAAGMMTCGG and GTGGCAGTCGCCACGG were used. As the 907R
primer
mixtures,
the
primer
CCGYCTATTCCTTTGAGTTT,
CCGYCAATTCCCTTRAGTTT,
sequences
of
CCGYCAATTCMTTTRAGTTT,
CCGYCAATTTCTTTRAGTTT,
CCGYCAATTCCTTMAAGTTT
and
CCGCCAATTCCTTTGAATTT were used. Thermal cycling was performed under the
following conditions: denaturation at 96 ˚C for 20 sec, annealing at 50 ˚C for 45 sec,
and extension at 72 ˚C for 30 sec for a total of 20-25 cycles. The PCR cycle numbers
represent almost the minimum cycle numbers providing enough amplified products for
the cloning based on the preliminary PCR amplification experiments using the same
templates. The amplified rRNA gene products from several separate reactions at the
least number of thermal cycles were pooled and purified as previously described (Takai
et al., 2001). Cloning and sequencing were also followed by the procedure described by
Takai et al. (2001). Approximately 450 nucleotides of cloned rRNA gene fragments
were determined for single strand using M13M4 oligonucleotide primer. Representative
rRNA gene sequences were aligned and phylogenetically classified into certain
taxonomic unit using ARB software (Ludwig et al., 2004). Sequence similarity analysis
against the non-redundant nucleotide sequence databases of GenBank, EMBL and
DDBJ using the blastn (http://blast.ddbj.nig.ac.jp/top-j.html) was also conducted. Based
on phylogenetic assignments based on ARB software and similarity analysis, the clonal
abundance of bacterial and archaeal 16S rRNA genes in the clone library was estimated.
The representative 16S rRNA gene sequences used in this study were deposited in the
public database under the accession numbers (AB539594-AB539611).
Whole cell FISH analysis
Domain-specific whole cell FISH analysis was conducted to estimate the cellular
abundance of Bacteria and Archaea in the filamentous microbial community. The
targeted microbial cells were the whole microbial cells (DAPI-stained cells), the active
bacterial cells and the active archaeal cells which specifically bound to the EUB338
(Stahl and Amann, 1991) and the ARC915 (Amann et al., 1990) probes, respectively.
The FISH experiment was performed as previously described (Sekiguchi et al., 1999).
The frozen formalin-fixed sample was thawed, and then vigorously suspended with a
vortex mixer. After 5 min of static state, 0.5 ml of formalin-fixed supernatant was
centrifuged at a 15000 rpm at 4 ˚C for 30 min. After washing with a 0.5 ml of PBS (pH
7.2) twice, the microbial cells were immobilized on a positive charged glass slide.
Hybridization was performed with either the Alexa488-labeled EUB338 or the
Cy3-labelled ARC915 probes at 46 ˚C for 3 h. The hybridization stringency was
adjusted with varying concentrations of formamide in the hybridization buffer (10% for
the EUB338 probe and 30% for the ARC915). After the hybridization and the washing,
the cells were stained with PBS (pH 7.2) containing DAPI (10 µg/ml) for 30 min. The
slide was examined under an Olympus BX51 epifluorescence microscopy with the
Olympus DP71 digital camera system. The cells of E. coli strain K12 and
Methanothermobacter thermautotrophicus strain DSM1053 were used as the positive
controls. An average of the ratio of probe-hybridized cells to the DAPI-stained cells was
determined from more than 100 microscopic fields in several slides. Finally, the ratios
of active bacterial and archaeal cells in the filamentous community were estimated.
Preparation of a natural microbial community for micro FTIR spectroscopy
The frozen formalin-fixed sample was thawed and the several mm lengths of
filaments were picked by a sterilized tweezers and were placed directly on the CaF2
disks. The filaments on the CaF2 disks were washed with a 0.5 ml of PBS (pH 7.2)
twice and a 0.1 ml of DDW containing 1N HCl twice to remove iron oxide and
carbonate minerals. The filaments on the CaF2 disks were washed with DDW several
times and then were stained with DDW containing DAPI (10 µg/ml) for 2 h. Finally, the
filaments on the CaF2 disks were washed DDW several times and dried (whole
microbial community sample in Table 1). On the other hand, the thawed formalin-fixed
sample was vigorously suspended with a vortex mixer. After 60 min of static state, 1 ml
of formalin-fixed supernatant was centrifuged at a 15000 rpm at 4 ˚C for 30 min. After
washing with a 1 ml of PBS (pH 7.2) twice, the precipitation was washed with DDW
containing 1N HCl twice to remove iron oxide and carbonate minerals. Then, the pellet
was washed with DDW several times and then was stained with DDW containing DAPI
(10 µg/ml). Again, the pellet was washed with DDW several times and was finally
placed on the CaF2 disk (dispersive cell fraction in Table1).
Micro-FTIR measurement of cultured samples
In situ IR measurements of representative bacterial, archaeal and eukaryotic
cultures and lipids were conducted using an FTIR micro-spectrometer equipped with
narrow
band
mercury
cadmium
telluride
(MCT)
detector
(JASCO,
FTIR6200+IRT7000). A reference background spectrum was first measured at a place
away from the mounted sample (CaF2 alone), and then transmission IR spectrum of
sample was measured. One to more than one hundred points were measured within the
same sample, respectively (Table S1). The IR spectrum is described as IR absorbance as
a function of the wavenumber (cm−1):
absorbance = −log10T/T0
(1)
where T0 represents intensity of infrared light at each wavenumber for background and
T represents that for sample. Spot size of the analysis ranged from 50 µm × 50 µm to
300 µm × 300 µm depending on the choice of rectangular aperture. Sixty four to one
hundred scans were accumulated at 4 cm−1 spectral resolution in a range from 4000 to
1000 cm−1 according to the analyzed spot size and IR signal intensities. Blank test was
conducted by duplicate measurements at a position away from samples (CaF2 alone).
The IR spectral data were analyzed with a software program (JASCO, Spectra
Manager).
R3/2 values
In order to evaluate the spectral characteristics, we introduced the aliphatic
CH3/CH2 absorbance ratio (R3/2):
R3/2 = [asCH3]/ [asCH2]
(2)
where [asCH3] and [asCH2] represented peak heights of asymmetric stretching bands
for aliphatic CH3 (end-methyl; ~2960 cm−1) and CH2 (chain-methylene; ~2925 cm−1)
after linear baseline correction, respectively (Igisu et al., 2009).
Statistical analysis
The R3/2 values in the text are shown as mean  SD. The normality of the data was
verified with Shapiro-Wilk’s W test. For comparisons of the mean R3/2 values among
untreated, fixed, and stained cells in each domain, the Kruskal-Wallis test or one-way
analysis of variance was used as appropriate by applying the Bartlett’s test for
homogeneity of variances. Two-group comparisons (domain Bacteria and Archaea) of
the mean R3/2 values were performed using the Student’s t test followed by the F test for
homogeneity of variances. All testing was two-tailed, and a P value below 0.05 was
considered statistically significant.
Micro FTIR measurement of bacterial and archaeal cell mixture
The formaldehyde-fixed and DAPI-stained cell solutions of E. coli strain INV-α
and M. paludicola were observed with an Olympus BX51 epifluorescence microscopy
with the Olympus DP71 digital camera system. The cell density and the average cell
size were determined and the cell mixture solutions at various proportions of cell
number were prepared (Table S2). The dried cell mixture specimens on the CaF2 disks
were applied to micro FTIR measurement. Approximately 6 points were analyzed using
micro-FTIR to obtain aliphatic signatures of the cell mixtures. The analytical conditions
are as follows; 50 µm × 50 µm spot size, 1024 scans, and spectral resolution of 4 cm−1.
Micro FTIR measurement of a natural microbial community
Approximately 90 points were analyzed using micro-FTIR to obtain aliphatic
signatures from the microbial community identified by using the epifluorescence
microscopy (Olympus BX51). The analytical conditions are as follows; 50 µm × 50 µm
spot size, 1024 scans, and spectral resolution of 4 cm−1. IR spectra of the microbial
community showed absorption bands at ~3400 and ~1630 cm-1 (molecular H2O), ~2960
cm−1 (aliphatic CH3: end-methyl), ~2925 and ~2850 cm−1 (aliphatic CH2:
(chain-methylene), and ~1090 cm−1 (possibly Si-O due to amorphous silica) (bands
assignments after Bellamy 1954). In the microbial community, the 3400 cm−1 band due
to molecular H2O predominates and affects the small peaks of aliphatic CH, resulting in
the errors of R3/2 values of the small number of microbial community. The reliable CH
signatures from the microbial community can be obtained from at least more than
several tens of cells, although those from cultured prokaryotic cells could be obtained
frthe errors of R3/2 values of the small number of microbial community. The reliable CH
signatures from the microbial community can be obtained from at least more than
several tens of cells, although those from cultured prokaryotic cells could be obtained
from more than 10 cells (Fig. 2). For better R3/2 precision, only spectral data in which
CH peak heights were more than twice as large as those of blank were used. Among the
~90 IR spectra, 80 data (22 for the highly-concentrated sample, 58 for the slightly
concentrated sample) could be retained for further analysis.
R3/2 value of the microbial community can be determined as follows:
R3/2communitiy = ∑[asCH3]/∑[asCH2]
(3)
where ∑[asCH3] and ∑[asCH2] represent sums of peak heights of asymmetric
stretching bands for aliphatic CH3 and CH2 after baseline correction, respectively. The
mean R3/2 values of bacterial and archaeal cultures were obtained by stained
(Escherichia
coli,
Hydrogenimonas
thermophila,
Deferribacter
desulfuricans,
Clostridium sp., Bacillus subtilis, Streptococcus albus, Persephonella hydrogeniphila,
Methanopyrus
kandleri,
Thermococcus
stetteri,
Thermoplasma
acidophilus,
Methanocella paludicola), fixed (Thiomicrospira thermophila, Sulfurivirga caldicuralii,
Methylothermus
subterraneus,
Aeropyrum
camini,
Sulfolobus
acidocaldarius,
Acidianus brierleyi, Thermococcus kodakaraensis, Methanotorris formicicum), and
untreated cells (Synechocystis sp., Gloeobacter violaceus, Haloarcula japonica).
Although the stained bacterial and archaeal cultures are likely the best samples for
comparison with the microbial community, untreated and fixed cells were used for more
precise estimation of the mean R3/2 values of bacterial and archaeal cells because R3/2
values of untreated, fixed, stained cells have no systematic variation (P > 0.05 by
Kruskal-Wallis test). The mean R3/2 values of bacterial and archaeal cultures were
determined to be 0.65  0.05 and 0.94  0.08, respectively (P < 0.01 by Student’s t test).
The analytical errors were estimated from variations in absorbances by duplicate
measurements on the CaF2 disk. Therefore, the average abundance ratio of bacterial and
archaeal biomass in the microbial community can be defined as:
y = 0.29 x + 0.65
(4)
where x (= 0 - 1) is the abundance ratio of Archaea in the microbial community and y is
the R3/2 value of the microbial community R3/2community.
By applying the above eq.(3) to 80 spectral data on the microbial community,
R3/2community (y). Based on the above calibration equation (4), this will give the
abundance ratio of Archaea (x) (Table1).
Results
Intact polar lipid analysis
In the hydrocarbons released with HI/PtO2 treatment from the intact polar lipid
fraction, biphytanes (BPs) with a variety number of cyclpentane and cyclohexane rings,
phytane and pentakishopane (C35 hopane) were identified as isoprenoidal hydrocarbons,
in which the most abundant compound was BP[2] (8.2 µgC/g-sample), which contains
two cyclopentane rings in a biphytane structure. Several unknown compounds were also
detected in GC/MS analysis. In this study, it seemed likely that all the biphytanes and
phytane were derived from the archaeal components in the microbial filamentous
community. Totally, these biphytanes and phytane compounds were included in the
sample at a concetration of 22.94 µgC/g-sample.
In contrast, a variety of the straight-, branched-chain and unsaturated FAMEs (C15
to C20 carbon skeletons) were identified from the intact polar lipid fraction. The C16 and
C18 straight-chain FAMEs were the most abundant (4.0 and 2.7 µgC/g-sample,
respectively). The branched-chain FAMEs were also detected as the major FAMEs,
which accounted for 45% of FAMEs (i.e. i-C17, 1.56 µgC/g-sample; ai-C17, 1.16
µgC/g-sample). Surely, the fatty acids are the constituent of membrane lipids in both
eukaryotic and bacterial cells. However, in the microbial fliament sample, none of the
dominat eukaryotic components were observed. Thus, it would be concluded that all the
FAMEs were derived from the intact polar lipids of the bacterial cells. The hopanoids
are also known as a main constituent of bacterial membrane lipid. The C35 hopane was
indeed detected in GC/MS from the hydrocarbons released with HI/PtO2 treatment from
the intact polar lipid fraction. However, since it was not significant amount, the C35
hopane was excluded from the calculation. Finally, the fatty acid compounds were
tottaly included in the sample at a concetration of 14.48 µgC/g-sample.
The abundance of Archaea in the microbial commuity estimated from the IPL
analysis was 61%.
Quantitative PCR of 16S rRNA gene and 16S rRNA gene clone analysis
The numbers of archaeal and prokaryotic 16S rRNA genes were estimated to be
1.6 x 109 and 1.2 x 1010 copies g-1 sample, respectively. The abundance of archaeal 16S
rRNA genes in the entire prokaryotic 16S rRNA genes was calculated as 13 %.
All the archaeal phylotype detected in the prokaryotic 16S rRNA gene clone
library using a combination of universal primers were closely related with the Hot
Water Crenarchaeotic Group III (HWCG III) (‘Nitrosocaldales’) (Nunoura et al., 2005;
de la Torre et al., 2008), while diverse bacterial phylogroups such as the OP1,
Chloroflexi and Aquificales were found in the library. The clonal abundance of archaeal
sequences in the prokaryotic 16S rRNA gene clone library was calculated to be 41 %.
References
Amann, R., Binder, B.J., Olson, R.J., Chisholm, S.W., Devereux, R., and Stahl, D.A.
(1990) Combination of 16S rRNA-targeted oligonucleotide probes with flow
cytometry for analyzing mixed microbial populations. Appl Environ Microbiol 56:
1919–1925.
Bellamy, L.J. (1954) The Infra-red Spectra of Complex Molecules. New York, USA:
John Wiley & Sons.
de la Torre, J. R., Walker, C. B., Ingalls, A. E., Könneke, M., and Stahl, D. A. (2008)
Cultivation of a thermophilic ammonia oxidizing archaeon synthesizing
crenarchaeol. Environ Microbiol 10: 810-818.
Hirayama, H., Takai, K., Inagaki, F., Yamato, Y., Suzuki, M., Nealson, K.H., et al.
(2005) Bacterial community shift along a subsurface geothermal water stream in a
Japanese gold mine. Extremophiles 9: 169-184.
Hirayama, H., Suzuki, Y., Abe, M., Miyazaki, M., Makita, H., Inagaki, F., et al. (2011)
Methylothermus subterraneus sp. nov., a moderately thermophilic methanotrophic
bacterium from a terrestrial subsurface hot aquifer in Japan. Int J Syst Evol
Microbiol (DOI 10.1099/ijs.0.028092-0).
Igisu, M., Ueno, Y., Shimojima, M., Nakashima, S., Awramik, S.M., Ohta, H., and
Maruyama, S. (2009) Micro-FTIR signature of bacterial lipids in Proterozoic
microfossils. Precambr Res 173: 19-26.
Inagaki, F., Takai, K., Hirayama, H., Yamato, Y., Nealson, K.H., Horikoshi, K. (2003)
Distribution and phylogenetic diversity of the subsurface microbial community in
a Japanese epithermal gold mine. Extremophiles 7: 307-317.
Kobayashi, T., Koide, O., Mori, K., Shimamura, S., Matsuura, T., Miura, T., et al.
(2008) Phylogenetic and enzymatic diversity of deep subseafloor aerobic
microorganisms in organics- and methane-rich sediments off Shimokita
Peninsula. Extremophiles 12: 519-527.
Lane, D.J. (1985) 16S/23S sequencing. In Nucleic Acid Techniques in Bacterial
Systematics. Stackbrandt, E., and Goodfellow, M. (eds.). New York: John Wiley
and Sons, pp. 115–176.
Ludwig, W., Strunk, O., Westram, R., Richter, L., Yadhukumar, H.M., Buchner, A., et
al. (2004) ARB: a software environment for sequence data. Nucleic Acids Res 32:
1363-1371.
Nakagawa, S., Takai, K., Horikoshi, K., and Sako, Y. (2004) Aeropyrum camini sp.
nov., a strictly aerobic, hyperthermophilic archaeon from a deep-sea hydrothermal
vent chimney. Int J Syst Evol Microbiol 54: 329-335.
Nakagawa, S., Takai, K., Horikoshi, K., and Sako, Y. (2003) Persephonella
hydrogenophila sp. nov., a novel thermophilic, hydrogen-oxidizing bacterium
from a deep-sea hydrothermal vent chimney. Int J Syst Evol Microbiol 53:
863-869.
Nishihara, M., and Koga, Y. (1987) Extraction and composition of polar lipids from the
archaebacterium, Methanobacterium thermoautotrophicum, effective extraction of
tetraether lipids by an acidified solvent. J Biochem 101: 997-1005.
Nunoura, T., Hirayama, H., Takami, H., Oida, H., Nishi, S., Shimamura, S., et al.
(2005) Genetic and functional properties of uncultivated thermophilic
crenarchaeotes from a subsurface gold mine as revealed by analysis of genome
fragments. Environ Microbiol 7: 1967-1984.
Nunoura, T., Oida, H., Miyazaki, J., Miyashita, A., Imachi, H., and Takai, K. (2008)
Quantification of mcrA by fluorescent PCR in methanogenic and anaerobic
methanotrophic microbial communities. FEMS Microbiol Ecol 64: 240-247.
Oba, M., Sakata, S., and Tsunogai, U. (2006) Polar and neutral isopranyl glycerol ether
lipids as biomarkers of archaea in near-surface sediments from the Nankai
Trough. Organic Geochemistry 37, 1643-1654.
Pitcher, A., Hopmans, E.C., Schouten, S., and Sinninghe Damsté, J.S. (2009) Separation
of core and intact polar archaeal tetraether lipids using silica columns: Insights
into living and fossil biomass contributions. Organic Geochemistry 40: 12-19.
Sakai, S., Imachi, H., Hanada, S., Ohashi, A., Harada, H., and Kamagata, Y. (2008)
Methanocella paludicola gen. nov., sp. nov., a methane-producing archaeon, the
first isolate of the lineage 'Rice Cluster I', and proposal of the new archaeal order
Methanocellales ord. nov. Int J Syst Evol Microbiol 58: 929-936.
Schmidt, H. A., Strimmer, K., Vingron, M., and von Haeseler, A. (2002)
TREE-PUZZLE: maximum likelihood phylogenetic analysis using quartets and
parallel computing. Bioinformatics 18: 502-504.
Sekiguchi, Y., Kamagata, Y., Nakamura, K., Ohashi, A., and Harada, H. (1999)
Fluorescence in situ hybridization using 16S rRNA-targeted oligonucleotides
reveals localization of methanogens and selected uncultured bacteria in
mesophilic and thermophilic sludge granules. Appl Environ Microbiol 65:
1280-1288.
Stahl, D.A., and Amann, R. (1991) Development and application of nucleic acid probes.
In Nucleic acid techniques in bacterial systematics, Stackebrandt, E., and
Goodfellow, M. (eds.). New York, NY: John Wiley & Sons, Inc., pp. 205–248.
Takai, K., and Horikoshi, K. (2000) Rapid detection and quantification of members of
the archaeal community by quantitative PCR using fluorogenic probes. Appl
Environ Microbiol 66: 5066-5072.
Takai, K., Moser, D.P., Onstott, T.C., and Fredrickson, J.K. (2001) Archaeal diversity
in deep subsurface South African gold mine environments and phylogenetic
organization of archaeal domain. Appl Environ Microbiol 67: 5750-5760.
Takai, K., Hirayama, H., Sakihama, Y., Inagaki, F., Yamato, Y., and Horikoshi, K.
(2002) Isolation and metabolic characteristics of previously uncultured members
of the order Aquificales in a subsurface gold mine. Appl Environ Microbiol 68:
3046-3054.
Takai, K., Kobayashi, H., Nealson, K.H., and Horikoshi, K. (2003) Deferribacter
desulfuricans sp. nov., a novel sulfur-, nitrate- or arsenate-reducing thermophile
isolated from a deep-sea hydrothermal vent. Int J Syst Evol Microbiol 53:
839-846.
Takai, K., Nealson, K.H., and Horikoshi, K. (2004a) Methanotorris formicicus sp. nov.,
a novel extremely thermophilic, methane-producing archaeon isolated from a
black smoker chimney in the Central Indian Ridge. Int J Syst Evol Microbiol 54:
1095-1100.
Takai, K., Gamo, T., Tsunogai, U., Nakayama, N., Hirayama, H., Nealson, K.H., et al.
(2004b) Geochemical and microbiological evidence for a hydrogen-based,
hyperthermophilic
subsurface
lithoautotrophic
microbial
ecosystem
(HyperSLiME) beneath an active deep-sea hydrothermal field. Extremophiles 8:
269-282.
Takai, K., Nealson, K.H., and Horikoshi, K. (2004c) Hydrogenimonas thermophila gen.
nov., sp. nov., a novel thermophilic, hydrogen-oxidizing chemolithoautotroph
within the epsilon-Proteobacteria, isolated from a black smoker in a Central
Indian Ridge hydrothermal field. Int J Syst Evol Microbiol 54: 25-32.
Takai, K., Hirayama, H., Nakagawa, T., Suzuki, Y., Nealson, K.H., and Horikoshi, K.
(2004d)
Thiomicrospira
thermophila
sp.
nov.,
a
novel
microaerobic,
thermotolerant, sulfur-oxidizing chemolithomixotroph isolated from a deep-sea
hydrothermal fumarole in the TOTO caldera, Mariana Arc, Western Pacific. Int J
Syst Evol Microbiol 54: 2325-2333.
Takai, K., Miyazaki, M., Nunoura, T., Hirayama, H., Oida, H., Furushima, Y., et al.
(2006) Sulfurivirga caldicuralium gen. nov., sp. nov., a novel microaerobic,
thermophilic, thiosulfate-oxidizing chemolithoautotroph isolated from a shallow
marine hydrothermal system occurring in the coral reef, Japan. Int J Syst Evol
Microbiol 56: 1921-1929.
Takai, K., Nakamura, K., Toki, T., Tsunogai, T., Miyazaki, M., Miyazaki, J., et al.
(2008) Cell proliferation at 122 ˚C and isotopically heavy CH4 production by a
hyperthermophilic methanogen under high pressures cultivation. Proc Natl Acad
Sci USA 105: 10949-10954.