Supplemental Methods

advertisement
AFFYMETRIX MICROARRAY
All adipose tissues used in the study were inguinal subcutaneous adipose tissue. At
sacrifice, the adipose tissue (100 to 350 mg) was harvested, minced finely, placed into
5~10 volumes of RNALater™ (Ambion, Inc., Austin, TX), and stored in a -80C freezer
until further processing.
Tissue from RNALater™ stocks was weighed, transferred to Trizol reagent (Invitrogen,
Carlsbad, CA), and homogenized using the Mixer Mill system (Retsch, Haan, Germany).
The clear aqueous supernatant was transferred to RNeasy Mini columns (Qiagen Inc.,
Valencia, CA) and processed (including DNase I treatment) according to manufacturer’s
instructions. RNA integrity was assessed by OD260/280 ratio and 28S and 18S
ribosomal RNA ratio with Agilent BioAnalyzer (Agilent Technologies Inc., Palo Alto,
CA).
All RNA samples were randomized to avoid batch effects. Total RNA (5 g) from single
animals was individually converted into biotinylated cRNA using protocols
recommended by the microarray manufacturer (Affymetrix). Labelling quality was
assessed by cRNA yields and integrity monitored by Agilent BioAnalyzer.
The cRNA samples were re-randomized. Hybridization cocktails containing 10 g of
fragmented cRNA from single animals were loaded onto GeneChip® Mouse Genome
430A Array and hybridized overnight. Genechips® were washed and scanned using
Affymetrix fluidic stations and scanners. Intensity data were captured by Genechip
Computer Operating System using the algorithm, MAS 5.0 (Affymetrix Microarray
Suite, Santa Clara, CA), and probe sets with an intensity > 22.1 were considered present
in the tissue.
IMMUNOHISTOCHEMISTRY
Inguinal adipose tissue fixed in 10% neutral buffered formalin was paraffin-embedded
and sectioned (5-m in thickness). The sections were deparaffinized and microwaved (10
min) in Target Retrieval Solution pH6 (DAKO, Glostrup, Denmark) for antigen retrieval
as previously described (1). The sections were then quenched with Peroxidase Blocking
Solution (DAKO; 10 min), and blocked with 1% normal goat or rabbit serum (20 min).
Tissue sections were incubated (60 min) with goat anti-cytochrome c (1:500) (Santa
Cruz, Santa Cruz, CA), rabbit anti-UCP1 (1:2000) (Abcam, Cambridge, UK), or goat
anti-Hsp60 polyclonal antibody (1:200) (Santa Cruz, Santa Cruz, CA). After washing
with Wash Buffer, the sections were incubated with biotinylated rabbit anti-goat or goat
anti-rabbit IgG antibody (Vector Laboratories; 30 min), and then ABC reagent of
VECTASTAIN (Vector laboratories; 30 min). The reaction product was visualized by
incubation with DAKO Liquid DAB Substrate Chromogen (2 min) and immersed in
distilled water (3 min). The sections were counterstained with hematoxylin (2 min),
rinsed with distilled water, dehydrated, mounted with Entellan New (MERCK) and
cover-slipped.
MORPHOMETRIC ANALYSIS
Quantification of cytochrome c-positive areas was performed using eCognition
(Definiens AG, Germany). Five images from one section (total 0.705 mm2 area per slide;
5 sections per animal) were randomly acquired at x200 magnification using a light
microscope with DP70 system (Olympus, Tokyo, Japan) by two independent, blinded
pathologists. The acquired images were segmented using the algorithm of chessboard
segmentation into equal-sized (1 pixel) squares according to manufacturer’s instruction
(User Guide Cellenger Developer Studio 4.0, 2004; www.definiens.com). The segmented
objects with a blue image layer value < 160 were temporary selected as cytochrome cpositive area, and then the objects with a red image layer value < 150 and blue image
layer value > 100 were excluded from the final classification. Cytochrome c-positive area
per section was calculated as cytochrome c-positive area divided by the total area of
examined images, and expressed as m2/mm2. UCP1-positive multilocular cells on
acquired images were identified and counted by blinded pathologists, and expressed as
number of cells per 0.705 mm2.
QUANTIFICATION OF RNA AND MITOCHONDRIAL DNA BY QUATITATIVE REAL
TIME PCR
Adipose RNA was reverse-transcribed using ABI High Capacity cDNA Archive Kit
(Applied Biosystems, Foster City, CA) to make cDNA. Total adipose DNA was
extracted from homogenized inguinal adipose tissue (without RNALater™) according to
the manufacturer’s protocol (Promega, Madison, WI). The cDNA and DNA were subject
to quantitative real-time PCR (10 and 100 ng per reaction for cDNA and DNA,
respectively) as previously described (2), carried out with Universal PCR Master Mix 2X
(Applied Biosystems) using 7900HT Sequence Detector System (Applied Biosystems) as
recommended by the vendor. The primer/probe sequences are listed in the following
table, except Cidea (cell death-inducing DNA fragmentation factor, alpha subunit-like
effector A), which was ordered directly from Applied Biosystems. The relative
abundance of a target gene RNA was normalized to both housekeeping genes beta actin
(Actb) and 36B4 (Arbp), and expressed as fold changes as indicated in Tables 2A and 2B
in the text. Relative amounts of nuclear and mitochondrial DNA were determined by
Gapdh and cytochrome b, respectively, and the ratio of mitochondrial DNA to nuclear
DNA reflects the tissue concentration of mitochondria per cell (2).
Symbols
Gene Name
Forward Primer
Reverse Primer
PROBE
Acadm
acetyl-Coenzyme A dehydrogenase,
medium chain
TGACGGAGCAGCCAATGA
ATGGCCGCCACATCAGA
TGCTTACTGTGTGACAGAGCCCTCCG
Actb
beta actin
GAGCTATGAGCTGCCTGACG
AGTTTCATGGATGCCACAGGA
CATCACTATTGGCAACGAGCGGTTCC
Arbp
36B4 (acidic ribosomal
phosphoprotein P0)
GCTTCATTGTGGGAGCAGACA
TGCGCATCATGGTGTTCTTG
TCCAAGCAGATGCAGCAGATCCGC
Cat
catalase
GGATTATGGCCTCCGAGATCT
TAAAACGTCCAGGACGGGTAA
TTCAATGCCATCGCCAATGGCA
Cpt1b
carnitine palmitoyltransferase 1b,
muscle
AGGGCTCGCGCCTTCT
GAAGGGTCGTCGAGGATTCTC
CCCGAGACCTGGAGATGCAGTTC
Cs
citrate synthase
CCCCTGCCTGAGGGCTTAT
GCCAAGACACCTGTTCCTCTGT
TGGCTGCTGGTAACTGGACAGATGCC
Cyc1
cytochrome c-1
CCTGCCACAGCATGGATTATG
TTGGCTTCTTCCTCCGTGTAG
CGTACCGCCACCTGGTGGGAGT
Cycs
cytochrome c, somatic
GCAAGCATAAGACTGGACCAAATC
ATGCCTTTGTTCTTGTTGGCATC
TAAGAGAATCCAGCAGCCTGGCCTGTC
Dld
dihydrolipoamide dehydrogenase
TTGATACCAAAAACATCCTTGTAGCT
AGTATCTTCATCGATCGTGATTCCA
CGGGCTCAGAAGTTACTCCTTTTC
Hspa9a
mitochondrial heat shock protein 70 GCAAAGGTCCTGGAGAATGCT
TCGTTCTCCATCTGCTGTAAAGG
AAGGTGCCAGAACTACCCCTTCTGTGGT
Hspd1
mitochondrial heat shock protein 60 CCGAAGACGTTGACGGAGAA
TGCCACAACCTGAAGACCAA
CTCTAAGCACGCTGGTTTTGAACAGGCTAAA
Immt
inner membrane protein,
mitochondrial
CTGCCTGCCGTCGAAGTT
AGATGCCATGGAGAATGAAATGCGGAC
Mrpl15
mitochondrial ribosomal protein L15 AAGCCCAGTCCTAACTCCAGAA
TCTGCCACACTTCCTACCTCTTC
ACGGGAAAGACGTCCAAGAGATCGG
Opa1
optic atrophy 1 homolog
TTGCCTGGGAGACTCTACAAGAG
AATATGTCGTCGTGTTCCTTTCC
TTTCCCGCTTCATGACAGAACCCAA
Ppargc1a
peroxisome proliferative activated
receptor, gamma, coactivator 1
alpha
CATTTGATGCACTGACAGATGGA
CCGTCAGGCATGGAGGAA
CCGTGACCACTGACAACGAGGCC
Ppargc1b
peroxisome proliferative activated
receptor, gamma, coactivator 1 beta AGGAAGCGGCGGGAAA
CTACAATCTCACCGAACACCTCAA
AGAGATTTCGAATGTATACCACACGGCCTTCA
Sod2
superoxide dismutase 2,
mitochondrial
TCGCTTACAGATTGCTGCCTG
GTGCTCCCACACGTCAATCC
CAGGACCCATTGCAAGGAACAACAGGC
Timm8a1
translocase of inner mitochondrial
membrane 8 homolog a
CCCTCAGTTGCAGCATTTCA
GTGCACCAGCTGCTGGAA
CGAGGTGGAGACGCAGAAGCAGC
Ucp1
uncoupling protein 1, mitochondrial TCCTAGGGACCATCACCACC
GCAGGCAGACCGCTGTACA
TGGCAAAAACAGAAGGATTGCCGAAA
GCTGAGCAGGACAGAAAGGTAGA
CYTB
cytochrome b
TATTCCTTCATGTCGGACGA
AAATGCTGTGGCTATGACTG
ACCTGAAACATTGGAGTACTTCTACTG
Gapdh
glyceraldehyde-3-phosphate
dehydrogenase (genomic DNA
sequence)
CAAGGTCATCCATGACAACTTTG
ACCACAGTCCATGCCATCACTGCCA
GGGCCATCCACAGTCTTCTG
CITRATE SYNTHASE ACTIVITY IN ADIPOSE TISSUE
Citrate synthase activity was measured similarly to Bogacka et al (3) using a Sigma
Citrate Synthase Activity kit. Adipose tissue (~30 mg) was homogenized in the CelLytic
MT Cell Lysis Reagent (400 l) using the Mixer Mill system. An aliquot of the
supernatant (8 l) was transferred to the kit Assay Buffer supplemented with acetyl CoA
(final concentration = 0.3 mM), 5,5’-dithiobis-(2-nitrobenzoic acid) (0.1 mM) and
oxaloacetate (0.1 mM; added last) in a final volume of 200 l. Immediately after
oxaloacetate was added, changes in absorbance at 420 nm at 25 oC were measured during
a 10-min period using a modified kinetic protocol on SpectraMax Plus (Molecular
Device, Sunnyvale, CA). Protein concentrations in the lysate were determined using a
Micro BCA Protein Assay kit (Pierce Technology, Holmdel, NJ). The activity was
expressed as µmol · min–1 · g protein–1.
REFERENCES
1. Higashiyama,H, Yoshimoto,D, Okamoto,Y, Kikkawa,H, Asano,S, Kinoshita,M:
Receptor-activated Smad localization in Bleomycin-induced pulmonary fibrosis. J
Clin.Pathol. 2006
2. Strum,JC, Shehee,R, Virley,D, Richardson,J, Mattie,M, Selley,P, Ghosh,S, Nock,C,
Saunders,A, Roses,A: Rosiglitazone induces mitochondrial biogenesis in mouse
brain. J Alzheimers Dis 11:In press, 2007
3. Bogacka,I, Xie,H, Bray,GA, Smith,SR: Pioglitazone induces mitochondrial
biogenesis in human subcutaneous adipose tissue in vivo. Diabetes 54:1392-1399,
2005
Download
Related flashcards

Peptide hormones

65 cards

Molecular biology

64 cards

Peptide hormones

66 cards

Create Flashcards