Supplemental information
Activin C expressed in nociceptive afferent neurons is required for suppressing
inflammatory pain
Xing-Jun Liu, Fang-Xiong Zhang, Hui Liu, Kai-Cheng Li, Ying-Jin Lu, Qing-Feng
Wu, Jia-Yin Li, Bin Wang, Qiong Wang, Li-Bo Lin, Yan-Qing Zhong, Hua-Sheng
Xiao, Lan Bao and Xu Zhang 一
Supplemental methods
Microarray and real-time RT-PCR
Total RNA was isolated from the rat DRGs using the Agilent total RNA isolation mini
kit (Agilent Technologies Inc., Santa Clara, CA, USA) and used as templates for
cDNA synthesis. In vitro transcription was carried out using Agilent low RNA input
fluorescent linear amplification kit in the presence of Cy3- and Cy5-CTP. Synthesized
fluorescence-labeled cRNA was used for microarray hybridization. Hybridization
solution was prepared according to the in situ hybridization kit plus (Agilent
Technologies Inc.). Hybridization was carried out using custom microarray at 60℃
for 18 h in a dye-swap replication experimental design. Microarray scanner system
(Agilent Technologies Inc.) was used for data analysis. After feature extraction by
Feature Extraction software, log2 ratio values, which equal to the ratio of
Cy5-processed signal to Cy3-processed signal, were calculated and converted to fold
change. Genes with a log2 ratio > 1 (> 2-fold increase) were considered to be
up-regulated and < -1 (> 2-fold decrease) were considered to be down-regulated.
Following filtration and normalization of each qualified gene, hierarchical clustering
and visualization were carried out using Cluster 3.0 and TreeView software (Eisen
Lab, Stanford, CA, USA).
Two
oligonucleotides:
5’-CCACCCAGACCATGAATATAAGAGTTCTTGTGCTAAGGCCATATGACA
and
CCAACCT-3’
5’-TACCAAGACTCATCACCTGAACTCTCCTACCCAACTGAACTTGACCAAA
GGGAGA-3’, were used as the probes of rat Inhbc gene (GenBank: NM_022614).
For
real-time
RT-PCR
5’-TTTTGTGGCAGCCCAGGTAA-3’
analysis,
two
(forward)
primers
and
5’-AGCCAATCTCACGGAAGTCCA-3’ (reverse) for Inhbc gene (NM_022614) and
two
primers
5’-ATCACCATCTTCCAGGAGCGA-3’
(forward)
and
5’-AGCCTTCTCCATGGTGGTGAA-3’ (reverse) for inner control GAPDH were
designed. The SYBR PrimeScript RT-PCR Kit (Takara, Dalian, China) was used
according to its standard procedure. Normalization was done with GAPDH mRNA in
the same reaction.
Rat Inhbc gene clone
The cDNA of activin βC was cloned from mRNA of rat DRGs by RT-PCR methods
with a set of primer: forward primer 5’-ccatcgatcgatggcctcctccttgctcctgg-3’ and
reverse primer 5’-cccccgggggctaactgcacccacaggcctct-3’. The PCR products were
double-digested with Cla I and Xma I restriction enzymes. The digested products
were ligated into the vector double-digested with Cla I and Xma I enzymes from
pCAG-IRES-EGFP. The recombinant plasmid was sequenced and the sequence was
used to BLAST search in GenBank to confirm the nucleotide constitution.
In situ hybridization
The method for in situ hybridization was modified from the previously published
procedure (Wang et al., 2010). Briefly, lumbar (L) 4 and L5 DRGs were dissected out
from the anesthetized rats. Frozen DRGs were sectioned in a cryostat at a thickness of
14-μm and mounted on Probe-On Plus slides (Fisher Scientific, Hudson, NH, USA).
The
oligonucleotide:
5’-TCTCCCTTTGGTCAAGTTCAGTTGGGTAGGAGAGTTCAGGTGATGAGTC
TTGGTA-3’ was designed as the probe for rat Inhbc gene (NM_022614), and was
labeled at 3’-end with digoxigenin using DIG Oligonucleotide Tailing Kit
(Boehringer-Mannheim, Leves, UK). DRG sections were hybridized with the probe
(6~10 nM) for 18 h at 42℃. After washing, sections were blocked with 0.5% bovine
serum albumin (Sigma) for 1 h followed by incubation with alkaline
phosphatase-conjugated anti-digoxigen antibody (1:5,000; Roche Diagnostics GmbH;
Roche Diagnostics, Germany) overnight at 4℃. Sections were then incubated with a
mixture of nitro-blue tetrazolium and 5-bromo-4-chloro-3-indolyl-phosphate in
alkaline phosphatase buffer for 6~24 h for color development.
To determine the percentage of labeled neurons, a total of five sections selected
every four sections of L4 or L5 DRGs from at least three animals at each time point
were processed. Neurons with three times more densities than mean background
densities were counted. Mean background densities were determined by averaging
densities over defined areas of the neuropil devoid of positively labeled cell bodies,
and by comparing with the averaged densities of neurons in the sections processed
with sense probes or pre-absorbed antibodies for control. Percentage of labeled
neuron profiles in the total number of neuron profiles was analyzed. To determine the
size distribution of neurons, the neuron profiles with a clear nucleus were selected and
measured on three lightly stained sections. The size distribution was shown with the
data pooled from at least five rats, and the number of neurons in serial of per 100 μm2
was count. Image-Pro Plus 5.0 software (Media Cybernetics, Silver Spring, MD, USA)
was used to measure the area of the cell profiles expressed as μm2.
Immunohistochemistry
Rats were anesthetized and perfused through the ascending aorta with saline followed
by 4% paraformaldehyde and 0.02% picric acid. L4 and L5 DRGs were removed and
post-fixed in the same fixative for 1.5 h. The DRG sections were cut in a cryostat (14
μm). After antigen being retrieved with the Frozen Section Chemical Antigen
Retrieval Reagent (GenMed Scientifics, Wilmington, DE, USA), sections were
perforated with 0.5% Triton X-100 (Sigma) in phosphate buffered saline (PBS) for 1 h
and then blocked in PBS containing 10% donkey serum, 0.1% gelatin and 0.05%
Triton X-100 for 2 h. Sections were incubated over night at 4 ℃ with rabbit
antibodies against activin C (1:1,000; BlueGene, Shanghai, China) or goat antibodies
against βC subuint (1:100; Santa Cruz Biotechnology, Santa Cruz, CA, USA),
combined with goat or rabbit antibodies against CGRP (1:2,000; AbD Serotec,
Kidlington,
Oxford,
UK;
1:1,000;
DiaSorin,
Wokingham,
UK)
or
fluorescein-conjugated isoletin-I B4 (IB4; 1:1,000; Vector Labs, Burlingame, CA,
USA). Sections were then incubated for 30 min at 37 ℃ with FITC- and
Cy3-conjugated secondary antibodies.
The fixed L4 and L5 spinal cord segments of rats were also embedded in paraffin.
After deparaffinization and rehydration, the paraffin sections were incubated with
0.2% hydrogen peroxide in 0.1 phosphate buffer pH 7.3 containing 0.2% Triton
X-100 for 10 min at room temperature. After being washed 3 times in 0.02 M PBS for
5 min, the sections were boiled in citrate buffer (pH 6.0) for 30 min for antigen
retrieval. Sections were blocked by incubation with goat antiserum in TBST for 2 h at
room temperature and then incubated with goat primary antibody against activin C
(1:50, Sant Cruz) or the activin C antibodies pre-absorbed with corresponding
immunogenic peptides for 48 h at 4°C. After being washed 3 times in 0.02 M PBS for
5 min, the sections were incubated with biotinylated secondary antibodies in PBS for
1 h at room temperature and overnight at 4°C. After being washed 3 times in 0.02 M
PBS for 5 min, sections were incubated with a solution of diaminobenzidine and
nickel ammonium sulfate at room temperature, and then the staining was developed.
For quantitative analysis, a total of five sections from each DRG at each time
point were selected in every four sections. Five animals were analyzed in each group.
To determine the percentage of labeled neuron profiles, the number of immunostained
neuron profiles was divided by the total number of neuron profiles. The percentage of
labeled neurons in each subset of small DRG neurons was also counted.
Immunoprecipitation
The DRGs were lysed in ice-cold buffer (50 mM Tris, 150 mM NaCl, 0.1%
Triton-100, 10% glycerol, 0.5 mg/ml BSA and protease inhibitors). The suspended
lysate was immunoprecipitated with 0.5 µg goat anti-activin A antibody for 1 h at 4°C
and then with Protein G-Agarose for goat antibody overnight at 4°C.
Immunoprecipitates were collected and aspirated. The sepharose was resuspended in
RIPA buffer without SDS, washed at least 3 times, and incubated in SDS buffer for 20
min at 60°C. Then, immunoblotting was processed.
Cell culture and treatment
ND7-23 cells (ECACC, Salisbury, Wiltshire, UK) were cultured in DMEM medium
(Invitrogen, Grand Island, CA, USA) with 10% fetal bovine serum (Invitrogen), 100
U/ml penicillin /100 pg/ml streptomycin mixture (Invitrogen), and 2 mM L-glutamine
(Invitrogen) at 37℃. After being starved for at least 4 h, cells were pretreated with 20
ng/ml recombinant human-activin C (BlueGene) or vehicle (0.2% bovine serum
albumin in PBS) for 20 min, followed by 10-min incubation with 100 ng/ml nerve
growth factor (NGF; Sigma), 5.0 μM prostaglandin E2 (PGE2; Sigma), 10 μM
glutamate (Sigma), 50 mM K+, and 100 ng/ml tumor necrosis factor-α (TNF-α;
Sigma), respectively.
The DRGs collected from male rats (~180 g) were kept in L-15 medium
(Invitrogen) and digested with digestive mixture including 0.1 mg/ml DNase (Sigma),
1 mg/ml trypsin (Sigma) and 0.4 mg/ml collagenase (Sigma) for 30~45 min at 37℃.
Cells were mechanically dissociated with a flame-polished Pasteur pipette in L-15
medium. DRG cells were pelleted and re-suspended in the medium [DMEM : F-12
Nutrient Mixture (Invitrogen) = 1:1], supplemented with 10% fetal bovine serum and
100 U/ml penicillin/100 pg/ml streptomycin mixture at 37℃. After culture for 6 h, the
complete medium was replaced by the same medium without serum but N2
supplement (1:100; Invitrogen) was added. DRG neurons were cultured for 24 h
before use. After being starved for 48 h, cells were pretreated with 20 ng/ml activin C
or vehicle for 30 min, followed by 5-min treatment with 100 ng/ml NGF.
Intrathecal injection
The single intrathecal injection was performed through a puncture at the theca of rat
spinal cord into the subarachnoid space. The site for the subarachnoid puncture was
determined by a palpation at the iliac bone tuberosities, the spinous process of the last
lumbar (L) vertebra, and below lumbosacral space. The L5-L6 intervertebral spaces
were identified by sliding the index finger along the midline in the rostral direction. A
sterile needle (30-gauge, 0.5-inch in length) was approaching the midline of the
intervertebral space, with the bevel of the needle facing rostrally. When the needle tip
reached the intervertebral space for 2-3 mm in depth, the correct subarachnoid
positioning of the needle tip was verified by a brisk tail-flicking. Then, the reagent (20
μl) was injected into the subarachnoid space at the cauda equina region. The needle
was left in the place for 5 seconds before being withdrawn. Animals then recovered in
their home cages. A series of experiments was carried out to confirm the injection site.
We found that the methylene blue (in 20 µl saline) was distributed in the subarachnoid
space from the cauda equina to the lumbosacral enlargement 30 to 60 minutes after
intrathecal injection. Intrathecal injection was determined by the distribution of
methylene blue in the lumbosacral enlargement and cerebrospinal fluid (CSF), but not
in the epidural space and paravertebral tissues. During the dissection, the injection site
through the dura could be visualized but there was no obvious damage to underlying
structures.
For multiple intrathecal administration of reagents, a polyethylene-10 tube was
catheterized into the subarachnoid space of rats under sevoflurane anesthesia and
aseptic surgical conditions. The skin of operation region was prepared and draped.
The polyethylene tube (17-cm long) was sterilized by immersion in 70% ethanol, and
fully flushed with sterile water prior to the insertion. The vertebral arches of L6 and
sacral (S) 1 were exposed through a 2-cm vertical incision. A 27-gauge needle was
inserted through the L6-S1 intervertebral space to puncture the dura, and was then
withdrawn. After seeing a little CSF flow out, the catheter (3 cm in length) was
carefully introduced through the hole into the subarachnoid space at the rostral level
of the lumbosacral enlargement. Slight negative pressure was applied to the syringe
until CSF was obtained and 15~20 μl of saline was infused into the catheter. To seal
the catheter, a bead was made on the external end of the catheter by passing the flame
of a lighter. Then, the tube was subcutaneously imbedded. The rats carrying the
catheters were individually housed. All tests were performed 5 days after intrathecal
catheterization. When the experiments were finished, lidocaine (10 μl × 20 μg/μl) was
injected through the intrathecal catheter to induce the paralysis of hind limbs of all
experimental animals and, thus, to confirm that the injection site was appropriate. The
data obtained from animals which did not show paralysis of hind limbs were excluded
from the quantitative analysis.
Small interfering RNA and delivery
Four pairs of siRNA targeting activin βC and one pair non-targeting control siRNA
were designed and synthesized by GenePharma (Shanghai, China). After the
screening of pilot study from in vitro and in vivo, we found that a pair siRNA could
strongly reduce activin C expression. According to the siRNA sequence, a pair of
scramble siRNA control was designed and synthesized. The siRNA targeting activin
βC:
sense:
5’-GGGACAGCAACAUUGUCAATT-3’,
antisense:
5’-UUGACAAUGUUGCUGUCCCTT-3’. The non-targeting control siRNA: sense:
5’-UUCUCCGAACGUGUCACGUTT-3’,
antisense:
5’-ACGUGACACGUUCGGAGAATT-3’. The scramble control siRNA: sense:
5’-GGACAAGCACGAAUGUUCATT-3’,
antisense:
5’-UGAACAUUCGUGCUUGUCCTT-3’.
siRNAs were reconstituted with sterile RNase free water and mixed with the
transfection reagent polyethyleneimine (ExGen 500; Fermentas, Hanover, MD, USA),
10 min before injection to increase cell membrane penetration and reduce the
degradation (Xu et al., 2010). Polyethyleneimine was dissolved in 5% glucose buffer,
and 1 μg of siRNA was mixed with 0.18 μl of polyethyleneimine. In the screening of
pilot study, 4.0 μg siRNA or non-targeting control siRNA was intrathecally delivered
72 h before DRGs were dissected for immunoblotting. In the formalin test, 4.0 μg
siRNA or scramble control siRNA was intrathecally administrated 72 h before
formalin injection. In the CFA model, 4.0 μg siRNA or scramble control siRNA was
intrathecally injected, whereas 50 μl CFA was injected intraplantarly.
Lipofectamine 2000 transfection reagent (Invotrogen) was employed to delivery
the activin βC siRNA into ND 7-23 cells.
Behavioral tests
We performed the following tests double-blindly. The animal model was prepared by
injection of 100 μl CFA into the left hindpaw. The rats were habituated in boxes on an
elevated metal mesh floor for at least 30 min before tests. The paw withdrawal latency
to a noxious thermal stimulus (radiant heat test) was determined as the average of
three measurements per paw over a 5-min test period, and a cutoff time of 30 sec was
set to avoid tissue damage. The tactile withdrawal thresholds were determined when
there were three positive responses out of five stimuli with von Frey filaments
presented perpendicular to the plantar surface. Activin C dissolved in 0.2% bovine
serum albumin in PBS was intrathecally injected through a spinal catheter. For control,
the vehicle was injected in the same way.
For the formalin test, 50 μl of 5% (for activin C), 2% (for siRNA) or 1% (for
antibody) formalin in saline was injected into the plantar surface of left hindpaw. The
number of flinches were counted within the first phase (1~10 min) and the second
phase (10~60 min). Under brief diethyl ether anesthesia, the rats were intrathecally
pretreated with 200 ng activin C (in 20 μl) or vehicle for 15 min, or 4.0 μg siRNA or
4.0 μg scramble control siRNA (in 20 μl; GenePharma) for 72 h, or 2 μg antibodies
against activin C (in 20 μl; Santa Cruz Biotechnology), or activin C antibodies
denatured in boiling water bath for 30 min, or 2 μg normal goat IgG (in 20 μl; Santa
Cruz Biotechnology) for 30 min.
Figure legends
Supplemental Figure 1. (A) Immunoblotting with activin βC antibodies showed the
monomer of activin βC in HEK293 cells transfected with the plasmid expressing
activin βC. (B) Immunoblotting in a reduced condition showed the precursor (~60 kD)
and monomer (~12.5 kD) of activin βC in the lysate of L4 and L5 DRGs. The
immunoblot intensities of activin βC precursor and monomer in L4 and L5 DRGs
were decreased after peripheral inflammation. (C) In ND 7-23 cells treated with
activin βC siRNA, the level of activin βC was decreased (nor, normal). The
immunoblot intensities of activin βC were normalized to GAPDH (n = 7). ** P < 0.01
and *** P < 0.001, compared with control (Con). Data was shown as mean ± s.e.m..
Supplemental Figure 2. (A, B) Intrathecal treatment with activin C antibodies
denatured in boiling water bath could not alter the flinch behavior of rats induced by
1% formalin. (C, D) Intraplantarly injected activin C (100 ng in C and 1.0 μg in D)
did not affect the basal response to heat stimuli of rats. (E, F) Intraplantarly injected
activin C (100 ng in E and 1.0 μg in F) did not change the threshold of thermal
nociceptive response on post-CFA day 2. Data was shown as mean ± s.e.m..
Supplemental Figure 3. (A) Co-immunoprecipitation experiment showed that activin
A interacts with follistatin, but not with activin C, in the extract of rat DRGs. (B)
immunoblot analysis showed that activin A, but not activin C, induced Smad2
phosphorylation in cultured ND 7-23 cells. Moreover, activin C could not alter the
Smad2 phosphorylation induced by activin A. The data represent three independent
experiments with the similar results.