DETECTION OF DENGUE VIRUS AMPLIFIED BY REVERSE-TRANSCRIPTION
HELICASE-DEPENDENT AMPLIFICATION
Eishika Dissanayake1,2,3,*, Photchanathorn Prombun4, Nuntaya Pornmun5, Wansika
Kiatpathomchai4,6, Prida Malasit3,5, Prapat Suriyaphol2,3,#
1
Graduate Program in Immunology, Department of Immunology, Faculty of Medicine Siriraj
Hospital, Mahidol University, Thailand
2
Division of Bioinformatics and Data Management for Research, Office for Research and
Development, Faculty of Medicine Siriraj Hospital, Mahidol University, Thailand
3
Center for Emerging and Neglected Infectious Diseases (CENID), Mahidol University,
Thailand
4
Center of Excellence for Shrimp Molecular Biology and Biotechnology (CENTEX Shrimp),
Faculty of Science, Mahidol University, Thailand
5
Dengue Hemorrhagic Fever Research Unit, Office for Research and Development, Faculty
of Medicine Siriraj Hospital, Mahidol University, Thailand
6
National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science
and Technology Development Agency, Thailand.
*e-mail: eishika@gmail.com, #e-mail: prapat.sur@mahidol.ac.th
Abstract
Dengue virus (DV) is a mosquito-borne virus causing a heavy disease burden.
Polymerase chain reaction (PCR) based methods allow rapid, specific detection, but are
limited by the need for thermal cycling. Reverse-transcription Helicase-dependent
Amplification (RT-HDA) is an isothermal technique which allows amplification at a constant
temperature making it more suitable for field and bed-side testing. In this study we optimized
conditions for amplifying DV serotype 1 strain Hawaii (DV1) and DV serotype 3 strain H87
(DV3) using RT-HDA. We also tested the use of colloidal nanogold particles (AuNPs) and a
lateral flow dipstick (LFD) for the detection of the RT-HDA product.
We designed serotype-specific primers for DV1 and DV3 and optimized NaCl and
MgSO4 levels to obtain maximum sensitivity of the RT-HDA reaction. When optimized the
sensitivity was 104 FFU/ml and 102 FFU/ml for DV1 and DV3 respectively. We then
hybridized the DV1 RT-HDA product with a AuNP probe functionalized with a DNA
sequence complementary to the DV1 amplicon. Any visible color change of the AuNPs with
the addition of MgSO4 from red to blue/purple was recorded and analyzed spectroscopically.
The DV3 reverse primer was labeled with biotin and a FITC-labeled probe complementary to
the DV3 RT-HDA product was designed. RT-HDA was performed with the biotin-labeled
primer followed by FITC probe hybridization. The complex was detected using the
Milenia® GenLine HybriDetect LFD.
The DV1 product hybridized with the AuNP probe remained red giving an absorption
peak at 520 nm with MgSO4 addition. The negative control and blank turned blue-purple
with MgSO4 shifting the peak to 600 nm. The color change was seen with 105 FFU/ml of
DV1 RNA. The DV3 product was detectable with the LFD upto 104 FFU/ml.
This study is the proof of concept that DV can be amplified using RT-HDA and
detected by the naked eye using AuNPs or LFD. With optimization and improvement it is
possible to detect the amplicon with both AuNPs and LFD with greater sensitivity.
Keywords: reverse-transcription helicase-dependent amplification, dengue virus, gold
nanoparticles, lateral flow dipstick
Introduction
Dengue virus infections may be asymptomatic or lead to a variety of presentations.
The features of dengue fever (DF) may be non-specific thus leading to a dilemma in early
diagnosis and also complications such as dengue haemorrhagic fever (DHF) and dengue
shock syndrome (DSS). The timely diagnosis of DF and DHF/DSS can be the single most
important factor that determines the outcome of the disease. The polymerase chain reaction
(PCR) is the most commonly used DNA amplification method for detection of DV as it is
rapid and sensitive allowing very early detection. However, the need for an expensive
automated thermal cycler and for expertise in performing the reaction itself limits the
application of PCR in field studies and point-of-care (PoC) diagnosis. This has led to the
development of isothermal amplification methods. Helicase-dependent isothermal DNA
amplification (HDA) is a relatively new and simple technique for amplification of nucleic
acids [1]. This method uses a helicase enzyme to unwind the duplex DNA eliminating
temperature cycling. Recent studies demonstrate that HDA can be combined with reverse
transcription reaction to detect an RNA target and is known as RT-HDA [2].
The method used for detection of the amplified nucleic acid target becomes
particularly important if a diagnostic test is to be suitable for PoC diagnosis. Ideally a PoC
diagnostic device should be universally applicable. As DF and DHF are prevalent in areas
rampant with such challenges, a detection system for DV should be cheap, sensitive and userfriendly.
Spherical gold nanoparticle (AuNP) colloids are red in color. Increasing the salt
concentration in the environment causes AuNP aggregation changing the color to blue-purple
[3, 4] . AuNPs can be functionalized with DNA probes and have been used for detection of
various organisms [5, 6] . When such a probe binds complementary DNA, the AuNPs
tolerate higher salt concentrations allowing the red color to persist. Here we use this
phenomenon to detect DV serotype 1 (DV1) RNA amplified isothermally RT-HDA. We also
explore the possibility of a lateral flow dipstick (LFD) for detection of DV serotype 3 (DV3).
This LFD uses an analyte complexed with biotin and FITC for detection of the RT-HDA
amplicon.
Optimizing these detection methods to achieve greater sensitivity will make PoC
diagnosis for DV closer to reality.
Methodology
Primer and probe design
Whole genome sequences of DV1 and DV3 were obtained from sequence data published
in the Genbank database. Complete genomes were aligned using ClustalW2.The primers for
RT-HDA were designed using the Primer3 software [7] from the C-prM region which was
the most conserved. The criteria for primer design recommended in the IsoAmp II Universal
tHDA kit (New England Biolabs, Beverly, MA, USA) were followed. For AuNP-based
detection, a DNA probe was designed to complement the DV1 RT-HDA amplicon. The
probe was labeled with a thiol group at the 5’ end and was functionalized on the AuNPs using
the protocol reported by Suebsing et. al. [8]. For LFD-based detection, the DV3 reverse
primer was labeled with biotin and a FITC-labeled probe complementary to the DV3 product
was designed. The primers and probes used in this study are given in table 1.
Name of primer/ probe
DV1-Fwd
DV1-Rev
DV1-Thiol probe
DV3-Fwd
DV3-Rev
DV3-Biotin
DV3-FITC
Primer/ probe sequence (5’
3’)
ACGGGTCGACCGTCTTTCAATATGC
TTTGAGAATCTCTTCGCCAACTGTGAA
AAAAAAAAAAGAGAAACCGCGTGTCAACTG
ACCATAGAGAATTCCACAGCAAATGT
ATCCTTTGTCTAAACCCATCAGGA
Biotin-ATCCTTTGTCTAAACCCATCAGGA
FITC-AGCCATAGCTAACCAGGCAG
Table 1: Primer and probe sequences used in RT-HDA, AuNP-based detection and LFD-based detection
RT-HDA assay
RNA from DV1 prototype strain Hawaii and DV3 prototype strain H87 was isolated
from the infected cell culture medium using QIAamp Viral RNA mini kit (QIAGEN, Hilden,
Germany) according to the manufacturer’s protocol. RT-HDA reactions were performed
using IsoAmp II Universal tHDA kit (New England Biolabs, Beverly, MA, USA) in a total
volume of 10 µl composed of 0.7 µl of IsoAmp Enzyme mix (DNA Helicase and Bst DNA
polymerase, New England Biolabs, Beverly, MA, USA), 4U SuperScript III reverse
transcriptase enzyme (SS III) (Invitrogen, Carlsbad, CA, USA), 1 µl of 10X annealing buffer
II, 0.7 µl of IsoAmp dNTP solutions, 0.15 µl of 5 µM forward primer, 0.15 µl of 5 µM
reverse primer and 2 µl of viral RNA. The MgSO4 and NaCl levels were optimized for each
serotype. The reagent mixture was amplified at 65 °C for 2 hours. Five microliters of the
product were loaded on to a 3.5 % agarose gel and electrophoresis was performed for 40
minutes at 100 V. The gel was stained with ethidium bromide and visualized in ultraviolet
light.
Optimization of RT-HDA reaction conditions
RT-HDA is very sensitive to NaCl and MgSO4 concentrations. Therefore we optimized
MgSO4 and NaCl concentrations to achieve peak performance. All optimization reactions were
carried out as described above. MgSO4 concentration was varied from 3 to 5 mM and NaCl
concentration from 10 to 50 mM for DV1 and DV3 templates. The reagent mixture was
amplified at 65 °C for 2 hours and product was run in a 3.5 % agarose gel for 40 minutes and
visualized under ultraviolet light following ethidium bromide staining. Results are given in
figures 1a and 1b.
AuNP-based detection of DV1
DV1 RNA was amplified using the RT-HDA protocol described above. Five
microliters of the product were heat denatured at 95 °C for 5 minutes and mixed with 3 µl of
an AuNP-labeled DNA sequence complementary to the DV1 RT-HDA product. The mixture
was incubated at 60 °C for 5 minutes, 40 °C for 5 minutes and 25 °C for 30 minutes. Two
microliters of MgSO4 were added giving a final concentration of 7.5 mM. Visible color
changes were recorded and 2 µl of the mixture were analyzed spectroscopically before and
after adding MgSO4. A negative control and a blank solution were analyzed likewise. The
resulting color changes and spectroscopic data are given in figures 2a, 2b and 2d. The
sensitivity of the system was checked using a 10-fold serial dilution of the DV1 RNA and the
results are shown in figures 2e and 2f.
Lateral flow assay-based detection of DV3
The LFA that we used in this study was based on previous work that uses the same for
the detection of the product from loop-mediated isothermal amplification (LAMP) amplicon
[9, 10]. The RT-HDA reaction was performed using the biotin-labeled DV3 primer. Five
microliters of the double-stranded biotin-labeled product was denatured by heating to 95°C
for 5 minutes. Eight picomoles of the FITC-labeled probe were then introduced in to the
product and the mixture was allowed to incubate at 60 °C for 5 minutes, 40 °C for 5 minutes
and 25 °C for 30 minutes. Eight microliters of the solution were pipetted onto the sample
application area of the LFD and then placed in 100 µl of HybriDetect Assay Buffer (Milenia
Biotec GmbH, Germany). The LFD was left in place for 10 minutes and the results were
observed (figure 3a). The amplicons were also run in a 3.5% agarose gel for 40 minutes at
100 V to confirm the results (figure 3b)
Results
Optimization of RT-HDA reaction conditions
The optimal MgSO4 and NaCl concentrations for the DV1 RNA template were found
to be 4 mM and 40 mM respectively. The DV3 template produced optimum results with 3.5
mM of MgSO4 and 40 mM of NaCl. Under optimal conditions the DV1 and DV3 templates
were detectable upto 103 and 102 FFU/ml respectively (results not shown).
a
b
Figure 1: Optimization of RT-HDA reaction conditions for DV1 prototype strain Hawaii (a) and DV3
prototypestrain H87 (b). The graphs show the amount of product DNA vs. MgSO4 concentrations for
variousNaCl concentrations.
AuNP-based detection of DV1
The reaction containing the DV1 product remained red giving an absorption peak at
520 nm before and after MgSO4 addition. The negative control and blank turned blue-purple
with MgSO4 giving absorption peaks at 600 nm (figures 2a and 2b). The AuNP-based system
was only able to detect 105 FFU/ml of RNA (figure 2e and 2f).
a
b
Positive
Negative
Positive
Blank
c
Negative
Blank
d
100 bp
83 bp
M
1
2
3
4
5
e
f
M
1
2
3
4
5
6
1
2
3
4
5
7
Figure 2: a) Five microliters of product from RT-HDA with DV1 RNA template (positive), negative control
(negative) and blank containing water (blank) after incubation with 3 µl of AuNP-labeled DNA probe prior to
addition of MgSO4. All tubes express a bright red coloration. b) Color changes observed with the addition of
MgSO4. The presence of a target complementary to the AuNP-labeled probe allowed the red colour to persist
(positive) while its absence resulted in a blue-purple. c) Results of agarose gel elecctrophoresis. M: 100 bp
marker; lanes 1 and 2: positive, lanes 3 and 4: negative, lane 5: blank. d) Visible spectra corresponding to
figures 2a and 2b. Prior to addition of MgSO4 the absorption peaks were at 520 nm. With MgSO4, the
6
7
complementary target DNA helped retain the absorption peak at 520 nm while aggregation in the absence of the
target shifted the peak to 600 nm. e) Sensitivity of AuNP-based detection. Top panel shows the color of the
solutions with the addition of AuNPs; bottom panel shows color changes with MgSO 4. Tube pairs 1-5: 105 – 101
FFU/ml, pair 6: negative control, pair 7: blank (water) f) Agarose gel electrophoresis corresponding to reactions
in fig. 2e. M: 100bp marker, lanes 1-5: 105 – 101 FFU/ml, lane 6: negative control, lane 7: blank (water).
Lateral flow-based detection of DV3
The LFD was sensitive up to a dilution of 104 FFU/ml of DV3 RNA. This sensitivity
was 100 times less than that of agarose gel electrophoresis (figures 3a and 3b).
a
b
1
9
2
3
4
5
6
7
8
M
M
1
2
3
4
5
6
7
8
M
Figure 3: Sensitivity of lateral slow assay. a) 1 – 7: 107 – 101 FFU/ml, 8: negative control b) Agarose gel
electrophoresis of reactions tested in 4a. M: 100 bp marker, lanes 1 – 7: 107 – 101 FFU/ml, 8: negative control
Discussion and Conclusions
In this study we optimized RT-HDA reaction conditions for the detection of DV1
prototype strain Hawaii and DV3 prototype strain H87. We also explored two detection
methods for the RT-HDA amplicon, namely AuNP-based detection and an LFD.
The RT-HDA reaction is very sensitive to NaCl and MgSO4 concentrations. Therefore
we optimized these conditions and for each serotype. The optimal NaCl concentration for
both serotypes was the same and the optimal MgSO4 concentration different by only 0.5 mM.
The practically identical optimal conditions are advantageous and aid the development of a
multiplex assay. Under optimal conditions the sensitivities for DV1 and DV3 were 103 and
102 FFU/ml respectively.
The sensitivity of DV1 was 105 FFU/ml using the AuNP-based system. This was 100
times less sensitive than gel electrophoresis. If there is a dearth of the amplicon or an excess
of AuNP probes, there will be free AuNPs which will aggregate with salt addition leading to
a falsely negative result. On the contrary, even with adequate amounts of the amplicon and
AuNP probe particles, if the salt concentration is inadequate this can cause a false positive.
Therefore by optimizing the AuNP probe and MgSO4 concentrations we believe that better
sensitivity can be achieved.
The DV3 template was detectable up to a concentration of 104 FFU/ml while gelbased detection was 100 times more sensitive. Here we used one biotin-labeled primer and
one FITC-labeled probe to hybridize with the amplicon which allows only one half of the
amplicon to be captured on the LFD. To harness the maximum amount of amplicon, we
believe that using 2 probes and optimizing the probe concentrations will make the system
more sensitive.
By optimizing these systems, we believe that a cheap, sensitive and rapid point-ofcare diagnostic device can be developed for use for bed-side diagnosis of DV.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
Vincent, M., Y. Xu, and H. Kong, Helicase-dependent isothermal DNA amplification. EMBO
Rep, 2004. 5(8): p. 795-800.
Goldmeyer, J., H. Kong, and W. Tang, Development of a novel one-tube isothermal reverse
transcription thermophilic helicase-dependent amplification platform for rapid RNA detection. J
Mol Diagn, 2007. 9(5): p. 639-44.
Storhoff, J.J., et al., Sequence-dependent stability of DNA-modified gold nanoparticles. Langmuir,
2002. 18: p. 6666-6670.
Sato, K., K. Hosokawa, and M. Maeda, Rapid aggregation of gold nanoparticles induced by noncross-linking DNA hybridization. J Am Chem Soc, 2003. 125(27): p. 8102-3.
Seetang-Nun, Y., et al., Visual detection of white spot syndrome virus using DNA-functionalized
gold nanoparticles as probes combined with loop-mediated isothermal amplification. Mol Cell
Probes, 2013. 27(2): p. 71-9.
Suebsing, R., P. Prombun, and W. Kiatpathomchai, Reverse transcription loop-mediated
isothermal amplification (RT-LAMP) combined with colorimetric gold nanoparticle (AuNP)
probe assay for visual detection of Penaeus vannamei nodavirus (PvNV). Lett Appl Microbiol,
2013. 56(6): p. 428-35.
Rozen, S. and H. Skaletsky, Primer3 on the WWW for general users and for biologist
programmers. Methods Mol Biol, 2000. 132: p. 365-86.
Suebsing, R., et al., Loop-mediated isothermal amplification combined with colorimetric
nanogold for detection of the microsporidian Enterocytozoon hepatopenaei in penaeid shrimp. J
Appl Microbiol, 2013. 114(5): p. 1254-63.
Kiatpathomchai, W., et al., Shrimp Taura syndrome virus detection by reverse transcription loopmediated isothermal amplification combined with a lateral flow dipstick. J Virol Methods, 2008.
153(2): p. 214-7.
Khunthong, S., et al., Rapid and sensitive detection of shrimp yellow head virus by loop-mediated
isothermal amplification combined with a lateral flow dipstick. J Virol Methods, 2013. 188(1-2):
p. 51-6.