Progress Report
Introduction
In today’s society, the most commonly used phthalate in PVC products is the di(2-ethylhexyl) phthalate (DEHP). DEHP is broken down to its biological form to mono(2-ethylhexyl) phthalate (MEHP).The sky rocketing market and demands for Polyvinyl
chloride (PVC) containing products in today’s consumerists and industrialized world has
led to an increased production of plasticizers such as phthalate at an alarming and
dangerous rate. Phthalates enhance the flexibility and durability of plastics. Exposure to
products containing MEHP or DEHP into the human body is unavoidable. DEHP is
found in baby bottles, toys, food containers, blood storage bags and so on. The male
reproductive system is a primary target of DEHP. MEHP when introduced into the cell of
the body increases the body’s vulnerability to reactive oxygen species (ROS) (e.g. free
radicals) which can cause oxidative stress within the cell, particularly the mitochondria
(cell organelles responsible for ATP energy production for cell use). Therefore, the goal
for this research project is to investigate the effects of DEHP on the levels o
peroxiredoxin 3 (Prx3) mRNA.
The first week in the laboratory, there were not enough flies to be harvested for
my project so I took the liberty to do some background investigations into my project. I
looked into Drosophila melanogaster (the fruit fly) and why it is crucial for our research
project. . I learnt that Drosophila melanogaster commonly called fruit fly is a Greek name
meaning black-bellied dew lover is an insect with a short life span with its development
solely relying on temperature. For instance, at 28°C (82°F) it takes seven (7) days to
develop from egg to adult, at room temperature, it takes 8.5 days to develop(egg to adult)
1
and also it takes 11days to develop at 30°C (heat stress). Moreover, I learnt from
Margaret t. Fuller’s article entitled “Genetic control of cell proliferation and
differentiation in Drosophila spermatogenesis” that, the process by which the male germ
cell differentiate in Drosophila holds a striking resemblance to that of mammals(humans).
In that both flies and mammals possess just enough self-renewing stem cells that are
capable of dividing throughout their reproductive life, produce spermatogonial cells (later
undergo series of mitotic and meiotic divisions to become spermatids) and still maintain
the stem cell population as well. Therefore, looking into the male fly serve almost the
same purpose as of that of humans and besides it is safer and cost efficient. In addition,
according to a different article entitled “The Peroxiredoxin Gene Family in Drosophila
Melanogaster” by Svetlana N. Radyuk, Vladimir I. Klichko, Benedetta Spinola, Rajindar
S. Sohal and William C. Orr, on a genome wide search, Drosophila melanogaster
possesses five Peroxiredoxin genes which are sub-divided into 2-Cys and 1-Cys. The 2Cys has three peroxiredoxin genes; DPx-4156, DPx-4783 and DPx- 5037 while 1-Cys
sub-group consist of the other two; DPx-6005 and DPx-2540. All These five proteins
have the tendency to reduce hydrogen peroxide (H2O2) in the presence of dithiothreitol
when expressed in E.coli. All three proteins in the 2-Cys group were found to be active
in thioredoxin system and for thus was categorized as thioredoxin peroxidase. These
proteins were determined based on the variation in the patterns of their mRNA gathering
during their development. They tend to cluster in certain areas within the cell. For
instance, peroxiredoxin -3(DPx-5037) was located in the mitochondria of the cell. They
can produce thioredoxin reductase, which share a similarity in function with the
mammalian enzyme called glutathione reductase. This ability of insects to produce
2
thioredoxin reductase marks the significant role the thioredoxin system plays during
antioxidant defense. For my first week in the laboratory also, I ended up learning how to
calibrate of 100-1000µl, 20-200µl, and 5-50µl pipettes. The results from these
experiments were recorded as a graph which I have attached to my paper. My actual lab
research which was to test whether DEHP exposure to either 0.5ml or 1.0ml would affect
the Prx 3 mRNA levels in the adult male Dm. took place in the second week. At the end
of the research, the result was that the DEHP (both 0.5ml and 1.0ml) did not affect the
Prx3 mRNA levels in the Adult male Dm.
Materials and Methods
Sexing and Isolating of Male Dm.
To isolate male flies from a given sample, we used the ice method. This procedure is as
follows: Place test tube with flies in ice vertically and when they are knocked out gently
turn the test tube to lay on its side (horizontally).we Left test tube for five (5) minutes on
the ice and then .we then place index card on ice pak on the stage of dissecting scope.
Place sedated flies on the index cards and then view using your dissecting scope to isolate
the males (Male flies are slightly smaller in size and the back of their bodies is darker.
They also males have a group of spiky hairs around their reproductive parts and have a
more distinct black patched abdomen as well). Finally, the males were put into empty
glass vials and females into the morgue. The isolated males were starved male flies for
three (3) hours. This is immediately followed by treatment the isolated flies with either
0.5mMor 1.0mMDEHP (freshly prepared on that day) for 48 hours.
How DEHP was prepared
2µl DEHP was added to 5ml of 5% sucrose = 1mMof DEHP
3
1µl DEHP was added to 5ml of 5% sucrose= 0.5mMof DEHP
How 5% sucrose was made
We simply added 2g of sucrose to 40ml of distilled water
Following our 48 hour DEHP treatment, we isolated the total RNA from flies.
Isolating Total RNA Experiment
Total RNA isolation was done using a total RNA isolation system from Promega.
We wore gloves at all times and then disinfected working area and pipette thoroughly
with ethanol to avoid RNAse (RNA enzyme) contamination. We Pipette 300µl of
denature reagent (pre-chilled) to the DEHP treated flies and then sit test tubes with flies
on ice for five minutes. Next, we used a motorized pestle to carefully grind flies into
solution for 45- 60 seconds and after that, added 30μl of sodium Acetate to neutralize the
grind flies solution. We then inverted solution 4-5 times to make sure the solution is well
mixed. After, we added 300ul of the phenolchlorophyl (kept at 25°C for 15mins) and
then Inverted solution again for 3-5 times. We vortex the solution and then iced the
solution for 15 minutes. Then we spun vials with solution in a centrifuge for 20 minutes
at 4°C spinning for 10000g.Using a pipette, we carefully remove aqueous layer (RNA
extract) off the interphase of the spun solution. After that we Added 300ul of isopropanol
to the aqueous (aq) layer (since aq layer was around 300ul range).Deep froze the
isopropanol with the RNA extract for 30minutes at -20°C and then using a centrifuge, we
spun the cold solution again for 10 minutes for 10000g at 4C.Removed super part of the
solution and then added 1ml ice cold 75% ethanol to the pellet that was left. We then
Broke up the pellet with a 1000µl pipette tip and the centrifuged again for 10 minutes for
10000g at 4°C. We decanted super carefully, to avoid pouring out of pellet and then
4
allowed pellet to air dry for 15-20 minutes. After that we added nuclease free distilled
water to dissolve the dry pellets.
To determine RNA concentration
2µl of the RNA sample was concentrated with 248µl of distilled water and then placed
into UV plastic curettes. PCR was performed using the 2µl of each sample as a template.
Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) Analysis
We used the Improm 11 reverse transcriptase (RT ) system. 2Ug to 20UL reaction mix
was used. To convert mRNA to cDNA, we first denatured the RNA secondary structure
by exposing our solution to 70C for 5minutes. Then to 25C for 15minutes and then to
42C for 60 minutes. finally, we denatured the RT enzyme at 95C for 5minutes.
The following primers were used in the sequence (sequence 5’-3’); Dm 5037-F (Prx3
forward primer), GCCTCCTGCATCAAACCGCT; Dm 5037-R (Prx 3 reverse primer),
ATCGGGCTTAATGGTAGCCG; rp49-F (control forward primer),
CCGCTTCAAGGGACAGTATCTG; rp49-R (control reverse primer),
CACGTTGTGACCAGGAACTT. RT procedure is the same as with NEB except that we
added MgCL2 which is necessary for Improm RT. For RT results we used the Promega
Improm II Reverse Transcriptase System cat # A3800 lot 247177.We then used Cary
1UV/ VIS spectrophotometer to quantify our RNA. Primers are 10Um concentration.
PCR
We pipette 2ul of the RT product into 50ul reaction volume and then kept for for 5
minutes. We then left it again for 2 minutes at 95C, followed by 30 cycles of exposure to
30 second at 94C, 30seconds at 60C and 72C for 60 seconds respectively. For our final
extension, we kept for 10 minutes at 72C.
5
Ran Gel for DNA Identification
We indented wells into the gel and filled up the entire gel container with ethanol.
We mixed the samples together on a Para film; 10µl of Prx3, 10µl rp49, 5ul of dye. Using
the pipette, we transported the mixtures into individual wells. We then plugged in the gel
machine for 1hour, 30minutes to allow the solution to diffuse within the gel. After the
solution has evenly spread, we took the gel and exposed it to Ultra violet (UV) light to
absorb free radicals. Then we then photograph the results from our experiment. We then
scan the photograph o draw up our result on a graph. I have attached the graph to the
paper.
Picture A
CT 0.5 1.0 -RT (repeat reaction)
Prx3 RT- PCR product
Rp49 RT- PCR product
Picture A. represent both the mRNA primers
and the rp49 primers expression when we
ran them in a gel.
Conclusion
6
The result proved that 0.5µl and 1.0µl of DEHP did not have any significant impact on
the mRNA expression in Prx 3. Even though, mRNA levels was not affected does not
prove that proteins levels cannot be affected as well. Moreover, protein stability can be
affected without altering the mRNA levels. Therefore, further studies will be conducted
to determine the effects of DEHP on Prx 3 protein levels in the adult male dm.
.
7