partnership program
Molecular Genetics Workshop
Gel Electrophoresis of Digested DNA
Presented in collaboration with the
McMaster University Department of Biology
Description of Activity
Today your task will be to imagine you are designing a H1N1 vaccine. In order to do this you must
insert the DNA sequence of the H1N1 virus into a vector that is used to deliver the vaccine. Using the
DNA samples provided you must digest the DNA with restriction enzymes, and run them on an agarose
gel to separate the digested fragments by size. You will then stain the gel to visualize the DNA
fragments, and analyze whether you correctly inserted the H1N1 virus into the vector. Today’s activity
is an abbreviated example of some of the techniques and equipment used on a regular basis in molecular,
cellular and microbial biology research labs.
Please wear gloves at all times while handling equipment and/or samples during this lab exercise!
Useful Terms
Base: A type of particle that makes up a DNA chain – represented by A, T, C or G.
DNA sequence: A chain of bases that forms a code (or gene) that makes proteins and initiates biological
reactions.
Vector: A DNA sequence that is used to carry a gene, and get the gene to start making proteins and start
causing biological reactions.
Ligation: The act of bonding two ends of different DNA sequences together.
Restriction enzyme: A chemical that recognizes codes in DNA sequences and cuts DNA at these
sequences
DNA vector map: A simplified map that tells researchers what kinds of codes and genes are in a DNA
sequence
Gel electrophoresis: A technique that uses an electric charge to separate DNA sequences based on size.
1
MOLECULAR BIOLOGY BACKGROUND:
DNA exists as long chains of bases that we call sequences. These bases – or letters – form codes in DNA
sequences, and these codes make proteins that are needed for all processes that occur in our cells and in our
bodies. Scientists can manipulate DNA and put these codes together for many kinds of research purposes.
ACTGCGCTCGATAGAAATGCATGCAT
TGACGCGAGCTATCTTTACGTACGTA
1 base
DNA sequence
The length of DNA strands is measured according to the number of bases it has. DNA sequences are usually very
long, so we measure them in kilobases, where [1000 bases = 1 kilobase], or 1kb for short.
A process called gel electrophoresis allows us to see the different length of DNA samples. It works by sending
an electric charge through the gel from a negative to a positive end. This charge pulls any negatively charged
particles through it towards the positive end. DNA is negatively charged, so the electric charge will pull the DNA
sequences through the gel. Different sized particles will move at different speeds, the smaller ones will move
faster than the larger ones so we can use this as a way of measuring the lengths of DNA sequences. We use a
DNA ladder or marker that has samples of DNA at regular intervals to enable you to read the length of your DNA
samples in kilobases. We add dye to the DNA sequences so we can see it, and form the gel with grooves called
‘wells’ that allow us to put the DNA into the gel.
This is a photo of an electrophoresis gel with DNA samples in it:
DNA ladder
different DNA samples
Wells in gel for adding DNA
10kb marker
6kb marker
*
DNA travels in this direction –
away from the negative
charge and towards the
positive charge
3kb marker
+
Note how the shorter DNA sequences (eg 3kb) migrate further through the gel when compared to the larger (eg.
10kb) DNA sequences.
* This DNA band is lined up next to the 6kb marker, therefore we can assume it is about 6 kilobases long.
2
Researchers often use restriction enzymes to cut DNA sequences. Restriction enzymes recognize specific codes
in DNA that are 6 bases long called restriction enzyme sites, and cut DNA sequences in the middle of that site.
You can think of a restriction enzyme as a key, and the DNA code being the lock. There are hundreds of different
restriction enzymes and each of them recognize a specific code on DNA, just as a key can only open the lock that
it is made for. The restriction enzyme BgIII is an example.
Restriction enzyme BglII
+
ACTGGTCCACTGATAGCT|ACGTACGTACGCGCTCG
TGACCAGGTGACTATCGATGC|ATGCATGCGCGTGC
DNA sequence
Restriction enzyme site for BglII
=
ACTGGTCCACTGATAGCT|
TGACCAGGTGACTATCGATGC|
and
|ACGTACGTACGCGCTCG
|ATGCATGCGCGTGC
Original DNA sequence now cut into two DNA sequences!
After scientists use restriction enzymes to cut DNA sequences apart, they can join them back together using
another type of enzyme called ligase. Ligase acts like a glue to put together two DNA sequences end-to-end.
Using restriction enzymes, researchers can cut genes out of one DNA vector and ligate them into another.
In this way, researchers can cut and paste DNA to mix and match all kinds of genes for all kinds of purposes.
As mentioned, researchers often manipulate DNA sequences and genes to invoke different biological reactions. A
DNA vector is a DNA sequence that has been engineered to carry different genes into different cells, and turn on
these genes to get them to initiate different processes in cells. DNA vectors are in the form of a circular DNA
sequence, as opposed to a linear sequence. But a restriction enzyme can easily be used to cut the DNA sequence
and change it from its circular form into its linear form.
Restriction enzyme
+
Restriction enzyme BglIII
site for BglII
DNA vector circularized
=
DNA vector linearized
On one DNA vector there may be many different restriction enzyme sites, and there could be more than one site
for the same restriction enzyme. Scientists keep vector maps that let them know where each restriction enzyme
site is located on a vector.
3
Here is a map of the vector you will be using today:
All of the labels outside the DNA circle are restriction enzyme sites.
Note the size of the vector – it is 3049 bases long, or about 3kb
*
Vectors typically have a multicloning site labeled MCS for short on the map. There are lots of restriction enzyme
sites in this area and this is typically where researchers will digest the vector and ligate in a gene.
*
DNA Vector
Map
(3049bp)
4
TODAY’S EXPERIMENT:
Imagine you are designing the H1N1 vaccine. You have the DNA sequence of the vector that is to be used to
deliver the vaccine (shown above), and the only thing left to do is insert the DNA sequence for the H1N1 virus
vaccine itself. You have done a series of ligations to insert the sequence into the vector, and you now need to
determine whether or not the sequence has been successfully inserted.
To determine which reactions resulted in a successful insertion of the viral DNA you will need to do some
digestion reactions using restriction enzymes while referring to the DNA vector map and run them on a gel.
You have two unknown DNA samples (lettered) sitting in tubes on ice.
Each tube may contain either: the DNA vector OR the DNA vector + H1N1 gene [OR a mix of both].
The size of the vector is about 3kb (map on page 3). The size of the H1N1 gene is 2kb. Therefore, the size of the
vector that has the H1N1 gene successfully inserted is…?
DNA
vector
3kb
+
H1N1
gene
=
DNA vector
and H1N1
gene
__kb
The H1N1 gene has been inserted using the XbaI and XhoI restriction enzymes. Find where these are located on
the DNA vector map on p3. This means the H1N1 gene will now have these restriction enzyme genes on either
side of it.
XbaI
DNA vector + H1N1
gene
H1N1 gene
XhoI
REMEMBER: DNA needs to be linearized with 1 cut from a restriction enzyme before it can be run on a gel so
we can observe its length.
Use the enzymes to digest the different samples of DNA to enable you to figure out whether either of your
samples has H1N1 inserted.
A series of up to 4 reactions (2 for each DNA sample) using the two restriction enzymes provided (BglII and
NcoI) has been designed that will help you to determine what each sample contains. Look at the chart below with
your samples and refer to the vector map on page 3. You will need to label your tubes accordingly.
DNA sample
Restriction enzyme
Restriction enzyme
Sample A
XbaI
-
Sample A
XbaI
XhoI
Sample B
XbaI
-
Sample B
XbaI
XhoI
Some things to keep in mind when analyzing your gel:
5
Sometimes a DNA sequence that is digested
by a restriction enzyme(s) does not completely
digest all of the DNA. This results in faint
bands of DNA that are still undigested (circular
DNA), and may appear (incorrectly but
according to the ladder) to have a different
size.
PIPETTERS:
The use of pipetters is ubiquitous in modern biology to accurately dispense volumes less than 1.0 mL
(1000 μL). Using these devises is easy, but not obvious. Your reactions will not work well unless you
can operate the pipetters properly. Today you will be using a P20, which is used to dispense volumes in
the range of 2 to 20 μL.
Please note that the pipetters are on loan from the Department of Biology at McMaster University,
and their proper use is essential for us to continue running this workshop in the future!!
How to use a Pipetter
1) Open a container of disposable plastic tips (clear yellow). Place a plastic tip on the end of the
pipetter by firmly inserting the tip of the device into the tip in the rack and pressing down. You
should do this firmly enough so that the tip remains in the pipetter, but no harder.
2) Push the plunger on the end of the pipetter down with your thumb until you feel resistance and
hold it there. Immerse the tip so that it is at least a few millimeters under the surface of the
solution that you wish to pipette and slowly release you thumb’s grip. When you remove the tip,
the liquid that you have taken up into the tip should remain there and no bubbles should be
visible.
3) To dispense the liquid you have drawn up; touch the tip to the inside of the tube, and press down
with your thumb all the way to the first resistance point. To expel the last bit of liquid, you will
have to press down through the resistance point until you can press no further. All liquid should
now be expelled.
4) Use the ejector button, located at the end of the pipetter, to get rid of the disposable plastic tip in
the waste containers or bags provided.
If you have any doubts about whether you are operating the pipetter correctly, consult your activity
leader.
Adapted from: Biology 3H03 Mini-manual for Laboratory Exercises. William P. Sheffield, Associate
Professor, McMaster University, January 2003.
6
PROTOCOL:
PART 1: DIGESTING DNA
The lettered DNA samples given to you are ready to be digested which means all they need is the
addition of the restriction enzyme and heat.
To digest a DNA sample:
1) Add 2µL of one or both restriction enzymes to the lettered tube of DNA. (The DNA is green
because we have already added a dye so that it can be seen in the gel)
2) Mix well with the pipette tip.
3) Label the tube with the restriction enzyme(s) you added.
4) Place in the 37°C water bath for 10 minutes.
5) While the DNA is digesting, discuss what possible results you might expect and fill in chart at
bottom of page. HINT: use the chart you filled in on page 4, and the example digest on page 9.
PART 2: RUNNING THE GEL
6) Prepare the electrophoresis unit. Carefully remove the comb from the agarose gel, without
ripping the gel or the wells. Place the gel and the tray in the electrophoresis apparatus, with the
top (where the wells are) at the end where the power unit will be placed.
7) Carefully and slowly pour 1X TAE electrode buffer into the apparatus to completely immerse
the gel in buffer.
8) Loading your sample. Starting on the leftmost lane, add the DNA ladder (a standard marker) to
the gel. Then add your DNA samples. Be sure to write down which well you added each sample
to. You will use this to verify your electrophoresis results.
9) To add the DNA ladder to the gel, pipette up 10 μL. Carefully approach the gel, guiding your
pipette tip under the surface of the buffer and either just into, or just above the well.
10) Slowly release a little sample. It should quickly sink down into the well, making it immediately
more visible. If your pipetter is too far up, the sample will not sink into the well, if it is too low
down, you will rip out the bottom of the well. If this happens, simply move over one well and do
better on this one (you will have more wells than samples).
11) Repeat this process with 20 μL of your DNA samples into adjacent wells.
12) Assembling your Electrophoresis unit. Once your gel as been completely loaded, place the lid
on the electrophoresis apparatus. Next push the power unit into the prongs at the top of the unit.
13) Now, you can turn the power supply ON. Set the current to go from negative (closest to the
wells) to positive (furthest from the wells), and set the voltage to 100V.
14) If all is well, you should see some bubbles rising in the buffer from the wires inside the unit. The
tracking dye should be seen moving past the wells towards the bottom of the gel after a few
minutes. If the opposite is happening—the dye is moving towards the small end of the gel--stop
everything and make sure you have set the current to flow in the correct direction. Consult your
activity leader if you have any questions.
15) Run the gel for 30-40 minutes (until the loading dye has reached 4 lines from the bottom of the
gel tray). Turn the power unit OFF after this time. Carefully remove the gel tray form the
electrophoresis apparatus, making sure not to let the gel fall out of the tray (ie., hold the tray by
the open ends).
16) Your activity leader will take each gel and place it into 100x Fast Blast DNA stain for staining
for 3 minutes. Destain the gel for about 5 minutes in 100 mL of deionised water in a hot water
bath at 45 ◦C. Destain for 5 more minutes in water at room temperature. Change the water
and destain for 5 more minutes or until the DNA bands are visible.
7
17) After you have stained your gel, you can examine it. Use the DNA standard marker bands as a
reference point to estimate the fragment size of your digested DNA sample. Use the figure on
page 9 to decipher the size of each band.
Adapted from: Biology 3H03 Mini-manual for Laboratory Exercises. William P. Sheffield, Associate Professor, McMaster
University, January 2003.
Expected Results
Restriction enzyme
Vector only
XbaI
Vector only
XbaI
Vector-H1N1
XbaI
Vector-H1N1
XbaI
Restriction enzyme
-
XhoI
-
XhoI
Number of cuts
Expected size of
band 1
Expected size of
band 2?
Expected size of
band 3?
Questions:
1) Why is it necessary to run the gel in an electrode buffer?
2) Why is it important to set the direction of the electrophoresis current from NEGATIVE to
POSITIVE towards the end of the gel? What would happen if we reversed the charges?
3) Which fragments (large vs. small) are expected to travel the furthest from the well? Why?
4) What other applications can this technique be used for?
5) If there is not enough DNA to make enough of the H1N1 vaccine, what technique could you use
to get enough DNA?
6) If you were to cut this vector with restriction enzyme SacI and run it on an electrophoresis gel
what size(s) and how many DNA bands would you see? What about the vector and H1N1?
7) What uses can you think of for restriction enzymes in nature?
8) If you were to cut the vector with a blunt end restriction enzyme (cuts straight through DNA
rather than zig zag as shown on page 3) and ligate a gene that also had blunt ends, what might
you do to check if the gene has been inserted backwards or forwards?
9) How could restriction enzymes be used in forensics?
10) How many different restriction enzymes are theoretically possible?
8
Helpful Diagrams:
1) Ladder map:
2) Example vector-H1N1 gel:
Vector-H1N1 digested with
both enzymes
Vector-H1N1 digested
with one enzyme
Partially
digested
5kB
(vector+H1N1)
3kB
(vector)
2kB
(H1N1)
3kB (vector)
+ 2kB (H1N1)
5kB (vector+H1N1)
9