Supplementary Information
Methods:
Direct sequencing of IDH1 and IDH2 exon 4 – For the IDH1 gene, 50 nanograms of
genomic DNA were amplified using the following primers: IDH1_sense 5’AATGAGCTCTATATGCCATCACTG-3’;
IDH1_anti
5’TTCATACCTTGCTTAATGGGTGT-3’ and conditions: denaturation step of 5 min at
95°C; amplification for 40 cycles (denaturation: 30 sec at 95°C; annealing: 30 sec at
61°C; extension: 30 sec at 72°C); final extension for 7 min at 72°C. For the IDH2
gene, 5 nanograms of genomic DNA were amplified using the following primers:
IDH2_sense
5’-ATTCTGGTTGAAAGATGGCG-3’;
IDH2_anti
5’CAGAAGAAAGGAAAGCCACG-3’ and conditions: denaturation step of 5 min at
95°C; amplification for 40 cycles (denaturation: 30 sec at 95°C; annealing: 30 sec at
59°C; extension: 30 sec at 72°C); final extension for 7 min at 72°C. All PCR
experiments were performed in 50 L final volume containing 1U of Fast Start DNA
Polymerase (Roche Applied Science, Mannheim, Germany), 10x PCR reaction buffer
containing 20 mM MgCl2, 200 M of each dNTP, and 0.25 M of each primer. The
two PCR products (526 and 492 bp, respectively) were purified and sequenced on an
ABI PRISM 3730 (Applied Biosystems, Foster City, CA) using the Big Dye
Terminator Cycle Sequencing Kit v 1.1 (Applied Biosystems) according to
manufacturer’s instructions.
HRM analysis for IDH1 and IDH2 mutations – For the second subset of 49
patients analyzed, that had more limited genomic DNA available, multiple
displacement amplification (GenomiPhi, GE Healthcare, Amersham, UK) was
performed according to the manufacturer’s instructions. Each PCR contained
approximately 20-40ng DNA, 250µM dNTPs, 0.2µM each primer, 1x Titanium Taq
buffer, 0.5U Titanium Taq polymerase (Clontech, Mountain View, USA) and 1x LCGreen Plus (Idaho Technologies, Salt Lake City, USA). PCRs and HRM analysis
were run on a RotorGene 6000TM real-time analyser (Qiagen, West Sussex, UK). The
PCR was run at 95oC for 5 minutes followed by 45 cycles of 95oC for 15 seconds and
64oC for 30 seconds and an elongation step of 72oC for 5 minutes, followed by
heteroduplexing steps of 95oC for 5 seconds then 50oC for 30 seconds, the high HRM
was run from 70oC to 95oC rising at 0.1oC/second. Any subsequent melt curves that
varied from any of the normal controls by more than a 5% confidence interval were
sequenced directly from the HRM products on an ABI PRISM 3130 sequencer
(Applied Biosystems). For samples that had mutations at this point, PCR and
sequencing was repeated to confirm the mutation on the corresponding genomic
DNA. For IDH1 R132 mutations, an 80bp fragment was amplified using primers
IDH1 F (5’-AAAATATCCCCCGGCTTGTGAGT -3’) and IDH1 R (5’CATGCAAAATCACATTATTGCCAAC-3’) and for IDH2 R140 mutations, a 163bp
fragment
was
amplified
using
primers
IDH2
F
(5’TTGTTGCTTGGGGTTCAAATTCT
-3’)
and
IDH2
R
(5’GGACTAGGCGTGGGATGTTTTT -3’).
IKZF1 deletion screening
IKZF1 deletions were assessed by genomic amplification using primers for the
identification of the most common deletions (Δ4-7, Δ2-7 and Δ4-8), as previously
reported (Iacobucci et al. Blood 2009). In addition, in order to exclude rare focal
deletions and losses affecting the entire gene, we performed a Multiplex Ligation-
dependent Probe Amplification (MLPA) assay using the SALSA MLPA kit P335-A1
(MRC Holland, Amsterdam, The Netherlands). According to the manufacturer’s
instructions, DNA (50 ng) was heated at 98°C for 40 minutes. The P335 probe mix
was added to the DNA and denatured at 95°C for 1 minute before incubation at 60°C
for 16 hours to allow the probes to anneal. Annealed probes were ligated and
incubated at 54°C for 10 minutes. Ligation products were amplified by PCR (35
cycles, 30 seconds 95°C; 30 seconds 60°C; 60 seconds 72°C) with SALSA PCR
primers. The PCR fragments were separated by capillary electrophoresis on the ABI
Prism 3730 DNA Analyzer. Genomic DNA from 1 healthy donor was used as a
control sample. Data was analysed using Coffalyser MLPA data analysis software
(http://old.mlpa.com/coffalyser/) and relative copy number was obtained after
normalisation of peaks against controls. Values between 0.75 and 1.3 were considered
to be within the normal range. Values below 0.75 indicated loss.
JAK2 mutation screening
JAK2 mutation screening was performed by ARMS PCR as previously reported
(Jones et al, Blood 2005).