Supplemental Material and Methods:
Mice. Pms2cre/cre; ApcCKO/CKO; R26R mice were generated by interbreeding Pms2cre/+;
R26R mice with ApcCKO/CKO mice. Pms2cre mice were backcrossed at least 3 times to C57Bl/6J
and subsequently maintained via interbreeding. Pms2cre/cre; Apc1638N/CKO or ApcMin/CKO; R26R
mice were generated by interbreeding Apc1638N/+ or ApcMin/+ mice with Pms2cre/+; ApcCKO/CKO;
R26R mice. Two different R26R (Rosa26 Reporter mice with either lox-stop-lox LacZ or
pCAGG lox-mTomato-lox mGFP) alleles were used. Mice were housed in a specific pathogen
free HEPA filtered room and were fed a diet of Purina PicoLab Rodent Diet 20. Both R26R
mouse strains were received from the Jackson Laboratory (Bar Harbor, ME).
Genotyping. A small amount of tissue from each mouse was used for genotyping. DNA
was isolated in 200 μL of Lysis buffer (50mM KCl, 10mM Tris pH8.3, 2mM MgCl 2, 0.1mg/mL
gelatin, 0.45% NP-40, 0.45% Tween-20) with 150μg of Proteinase K (Roche) incubated at 55°C
overnight, then inactivated at 95°C for 10 min. DNA was genotyped in a solution containing
10mM Tris-HCl, 50mM KCl, 1.5mM MgCl2, 0.5μM each primer, 0.2mM dNTPs, 0.69mM
Cresol Red, 10% sucrose and 0.5U Taq (Roche). PCR conditions were 93°C for 5 min, then 38
cycles of 93°C for 20s, 60°C for 20s, 72°C for 40s, then a final 72°C for 3 min. Mice were
genotyped for the wildtype Pms2 allele using the Pms2A (TTCGGTGACAGATTTGTAAATG)
and Pms2W (TCACCATAAAAATAGTTTCCCG) primers and for the cre allele using the CreF
(AACATTCTCCCACCGTCAGT) and CreR (CATTTGGGCCAGCTAAACAT) primers. Mice
were genotyped for the CKO allele with ApcF2.5 (TAGTACTTTTCAGACGTCATG) and
ApcR2 (AGTGCTGTTTCTATGAGTCAAC).
(GCCATCCCTTCACGTTAG),
common
(TTCTGAGAAAGACAGAAGTTA).
ApcMin mice were genotyped with wt
(TTCCACTTTGGCATAAGGC)
and
mut
R26R mice were genotyped for LacZ with mut
(GCGAAGAGTTTGTCCTCAACC), common (AAAGTCGCTCTGAGTTGTTAT) and wt
(GGAGCGGGAGAAATGGATATG).
(TCAATGGGCGGGGGTCGTT),
R26R mice were genotyped for GFP with mut
common
(CTCTGCTGCCTCCTGGCTTCT)
and
wt
(CGAGGCGGATCACAAGCAATA). Apc1638N mice were genotyped using HotStar Taq DNA
Polymerase (Qiagen) in a solution of 1X Buffer, 0.2mM dNTPs, 0.5μM each primer and 0.5U
HotStar Taq. PCR conditions were 95°C for 15min, then 40 cycles of 94°C for 60s, 58°C for
45s,
72°C
for
45s,
then
a
final
72°C
for
5min.
Primers
used
were
A
(TGCCAGCACAGAATAGGCTG) and B (TGGAAGGATTGGAGCTAACGG).
β-gal staining of whole mount intestine. Intestines were isolated and flushed with cold
PLP fixative (2% paraformaldehyde, 75mM Lysine, 75mM Na2HPO4, 10mM NaIO4). Intestines
were then cut longitudinally and washed in PBS (137mM NaCl, 2.7mM KCl, 8mM Na2HPO4,
1.5mM KH2PO4, pH 7.4). Intestines were cut into sixths and pinned in a dish with villi facing
up. Pinned intestines were incubated in cold PLP fix for 1 hour shaking at room temp. Next,
pinned intestines were washed in PBS and incubated in DTT solution (20mM DTT, 20% ethanol,
150mM Tris pH 8.0) for 45 min shaking at room temp. Next, pinned intestines were washed in
PBS and incubated in β-gal staining solution (2mM X-gal, 4mM K4Fe(CN)6, 4mM K3Fe(CN)6,
2mM MgCl2 in PBS) overnight shaking in the dark at 4°C. Lastly, pinned intestines were
washed in PBS and used for whole mount analysis or further processing for sectioning.
Scoring of β-gal+ foci in whole mount intestine. After staining the intestines for β-gal,
the number of positive villi were scored under a Leica MZ6 dissecting microscope at 20X power,
a 25mm2 field of view. The field of view represented 1/28 of each strip of small intestine, thus
1/168 of the entire small intestine (each strip was 1/6 of the entire small intestine). The 25mm 2
field of view represented 1200 villi, which extrapolates to 201,600 villi in the entire small
intestine. The number of β-gal+ villi were counted in each field of view and at least 20 β-gal+
foci were counted for each third of the small intestine. Nearby β-gal+ foci were considered
independent if not arising from the same crypt and surrounded by non-staining crypts.
Adenomas, which involved multiple villi, were scored by whole mount and in cross sections.
Microadenomas, which involved a single villus, were determined by scoring cross sections.
Isolating intestine for immunofluorescence or GFP.
flushed with cold fixative (2% paraformaldehyde in PBS).
Intestines were isolated and
Intestines were then cut
longitudinally and cleaned in PBS. Intestines were cut into sixths and pinned with villi facing
up. Pinned intestines were incubated in cold fixative for 1 hour shaking at room temperature in
the dark to protect GFP fluorescence from quenching. Finally, pinned intestines were washed in
PBS, adenomas were counted and processing continued for sectioning.
Sectioning. Pinned intestines were incubated in 30% sucrose in PBS overnight at 4°C in
the dark. Intestines were then layered into a standard cryomold (TissueTek 4557) with each
mold containing 1/3 of the small intestine or both the colon and cecum. OCT (TissueTek) was
placed between each section in the mold, typically 6 sections per mold. Cryomolds with tissue
were frozen and stored at -80°C. Intestines were sectioned in a cryostat at -20°C at 12μm.
Sections were placed on SuperFrost PlusGOLD slides (Fisher). For β-gal stained intestines,
slides were washed in PBS, counter stained in Nuclear Fast Red (Sigma), washed in water,
dehydrated in 90% ethanol, cleared with CitriSolv (Fisher), mounted with Permount (Fisher) and
finally covered with Fisherbrand Microscope Cover Glass (Fisher).
Laser capture microdissection of intestinal tissue for PCR. 8μm sections of β-gal
stained intestine were placed onto Superfrost Microscope slides (Fisher).
Sections were
examined using an ArcturusXT LCM instrument (Applied Biosystems) and β-gal+ or β-gal-
crypts/villi were attached to a CapSure Macro LCM Cap (Applied Biosystems) with an infrared
laser. Cells were resuspended in 50 μL Lysis buffer (PicoPure DNA Extraction Kit, Applied
Biosystems) and incubated overnight at 65°C, followed by inactivation at 95°C for 5 min. 1 μL
of lysed cells was used in the PCR. Reaction conditions were the same as used for genotyping.
Primers used for LCM isolated DNA were ApcF3.5 (ACTCAATAGGAAACAGTATG) with
either ApcR6 (GACTTTCTAGGATCGATTCTAG) to detect the recombined ApcCKO allele or
ApcR2 to detect the unrecombined allele. Band intensity was used to measure the relative ratio
of recombined to unrecombined DNA (Quantity One, Bio-Rad). A sample known to contain a
1:1 ratio of recombined to unrecombined was run on each gel and this sample was used to
normalize the unknown samples.
Immunofluorescence. Sections were washed in TBS (50mM Tris Base, 0.9%NaCl, pH
8.4) plus 0.1% Tween (TBST), isolated with a PAP pen (Research Products International) and
incubated in 1% BSA, 0.1% Triton, 5% Donkey Serum in PBS for 1 hour at RT. Sections were
then washed in TBST and incubated in primary antibody (rabbit anti-β-catenin H-102,
SantaCruz; TRITC-conjugated mouse anti-β-catenin, BD Transduction Labs; rabbit anti-βgalactosidase, Immunology Consultants Laboratory; or rabbit anti-ki67, AbCam) diluted 1:100
overnight at 4°C, washed in TBST and incubated in secondary antibody (anti-rabbit AlexaFluor
488, 555 or 633, Invitrogen) diluted 1:100 for 1 hour at RT. Again, sections were washed in
TBST, placed under coverslips with UltraCruz mounting medium with DAPI (SantaCruz), sealed
and stored in the dark. Sections were imaged two ways: Alexafluor488 or 555 secondary
antibody and TRITC were imaged with an upright fluorescent microscope (Leica DM-RXA or
Nikon 80i), while Alexafluor633 secondary antibody was imaged with a Zeiss confocal laser
scanning LSM 510 microscope.
Apoptosis detection.
ApopTag Plus Peroxidase In Situ Apoptosis Detection Kit
(Millipore) was used. Sections were treated according to the manufacturer’s protocol for tissue
cryosections and were counterstained with Nuclear Fast Red (Sigma).
Alkaline phosphatase detection.
Endogenous intestinal alkaline phosphatase was
detected using NBT/BCIP Ready-to-Use Tablets (Roche) (0.4mg/mL NBT, 0.19mg/mL BCIP,
100mM Tris, 50mM MgSO4, pH 9.5). Tetramisole hydrochloride (Sigma) was added at 5mM to
remove other endogenous phophatases. Sections were incubated with NBT/BCIP solution for 12 hours at room temperature.
Real-Time PCR. ~200mg of small intestine was homogenized using an IKA T10 Basic
homogenizer.
RNA was then isolated using the RNeasy Midi Kit (Qiagen) as per the
manufacture’s protocol.
cDNA was made using the SuperScript III First Strand Synthesis
System for RT-PCR (Invitrogen). 136ng of total RNA and oligo (dT)20 were used following the
manufacture’s protocol. 1/20 of the cDNA reaction was used for the Real-Time PCR. Primers
used for Real-Time PCR amplification were: β-actin F (GTCCCTCACCCTCCCAAAAG) and R
(GCTGCCTCAACACCTCAACCC); GAPDH F (GGTGAAGGTCGGTGTGAACG) and R
(CTCGCTCCTGGAAGATGGTG); and APC F (CCTATAATAGCACAAGACTAG) and R
(CATATCTCTGATGTTTCACTG). cDNA was amplified in a solution containing 10mM TrisHCl, 50mM KCl, 1.5mM MgCl2, 0.5μM each primer, 0.2mM dNTPs, 0.5X SYBR Green I
(Invitrogen) and 0.5U Taq (Roche). PCR conditions were 95°C for 3 min, 35 cycles of 95°C for
30s, 55°C for 30s, 72°C for 30s, and 72°C for 15s at which time fluorescence was measured,
finally 72°C for 5min. The PCR was performed and analyzed with the MyiQ Single Color RealTime PCR Detection System (BioRad). Experiments were run in triplicate. % fold change was
calculated by first determining the average cycle threshold (C T) value for each primer pair and
genotype. ΔCT = CT (Apc) – CT (average[β-actin and GAPDH]). ΔΔCT = ΔCT (Apc+/+) – ΔCT
(experimental). The % fold change = 2ΔΔCt * 100.
Statistics. Data were analyzed with StatPlus for Mac in Microsoft Excel. Fisher LSD post-hoc
test was used after ANOVA test. Chi2 analysis was performed using a 2X2 Table.