J. Pan et al.
Supplementary information
Text summary
(1) Supplementary methods
(2) Supplementary Figure 1
(3) Supplementary Figure 2
(4) Supplementary Figure 3
(5) Supplementary Figure 4
(6) Supplementary Figure 5
(7) Supplementary Figure 6
(8) Supplementary Figure 7
(9) Supplementary Figure 8
(10) Supplementary Table 1
(11) Supplementary Table 2
Supplementary methods
Plasmid construction
A targeting vector (pTV-2) was constructed by subcloning a 5.5-kbp DNA fragment,
excised by EcoRV and XbaI from the 5'-upstream region of the gene for JDP2, and a
2.3-kbp DNA fragment, excised by PstI and SalI from intron 1, into the pPNT vector
(Tybulewicz et al, 1991), to serve as the 5'-long arm- and 3'-short arm-homologous
regions, respectively. A DNA fragment of the mouse gene for cyclin A2 [nucleotides
(nts) -944 to +157; GeneBank NM_009828.2] was amplified by PCR and inserted in the
pGL3-basic vector (Promega, Madison, WI, USA) to generate pGL3-ccnA2-long (pA2L). The deletion mutants pA2-M (-533 to +157 nts) and pA2-S (-247 to +157 nts) were
prepared by use of the SacI and XhoI restriction sites. The potential transcription factorbinding elements were identified in the promoter of the gene for cyclin A2 using the
TFSEARCH program (Heinemeyer, 1998). The AP-1 sequence (TGAGTCACA), the
CRE (TGACGTCA) or both elements were mutated in pA2M by PCR-based sitedirected
mutagenesis
with
1
primer
5'-
J. Pan et al.
GCTCTGATAACGGATATCAGTGAaTaACAGGACAATTGGGACAGC-3' (forward
primer for AP-1), together with its complementary reverse primer (small capitals
indicated
mutated
bases),
and
5'-
CCGGCGCTTCTGGTGAaaTCACGGACTCCGGACGC-3’ (forward for CRE) to
generate pA2mAP1, pA2mCRE and pA2mm, respectively, with subsequent
confirmation by nucleotide sequencing. In addition, a series of deletions in the JDP2
promoter (BamHI to BamHI, 4,211 bp; HincII to BamHI, 1,782 bp; XbaI to BamHI,
1,614 bp; HincII to BamHI△-3xSmaI, 1,034bp and SmaI to BamHI, 522 bp) were also
constructed in the pGL3-Basic reporter vector. Lentivirual vectors pCAG-HIVgp,
pCMV-VSV-G-RSV-Rev and CSII-CMV-MCS-IRES2-Bsd were obtained from the
RIKEN
BioResource
Center
DNA
Bank
(http://www.brc.riken.jp/lab/cfm/Subteam_for_Manipulation_of_Cell_Fate/Lentiviral_
Vectors.html). CSII-CMV-MCS-IRES2-Bsd-JDP2 was constructed by inserting the
open reading frame of mouse JDP2 into a XhoI/BamHI site of the CSII-CMV-MCSIRES2-Bsd vector. pLKO.1 (RHS4080) and pLKOshp53 (RMM3981-9580048) were
purchased from Open Biosystems (Tokyo, Japan).
Generation and characterization of Jdp2-deficient mice
The strategy for knockout of the gene for JDP2 was described elsewhere (Nakade et al,
2007). The NotI-linearized targeting vector was introduced by electroporation into
E14tg2a ES cells (Niwa et al, 2000) and cells were selected in the presence of 200
μg/ml G418 (Sigma-Aldrich Co., St. Louis, MO, USA). Southern blots of XbaI-digested
genomic DNA from colonies of drug-resistant ES cells were allowed to hybridize with
an external probe derived from intron 1. Resistant colonies were subjected to Southern
analysis with a [32P]-labeled DNA fragment for hybridization outside the right arm,
2
J. Pan et al.
which recycled an XbaI band of 3.4 kb in the case of wild-type gene and of 4.7 kb in the
case of the correctly targeted allele. Two ES clones harboring the disrupted gene were
injected into C57BL/6 blastocysts for generation of chimeric mice. The progeny of
mating between chimeras and C57BL/6 mice were genotyped by Southern blot
hybridization of tail DNA and, also, by PCR with two primer pairs: (1) a forward primer
(5’-TATGGGTGATGACCTGCTGT-3’) from the 5’ upstream region of the promoter
and a reverse primer (5'-CAGGATCTCGCAAGCTTGTT-3') from exon 1, which
amplified a fragment of 788 bp from the wild-type gene; and (2) a specific reverse
primer (5'-TCCTCGTGCTTTACGGTATC-3') from the neomycin-resistance cassette
and the common forward primer, which amplified a fragment of 593 bp that was
specific for the targeted allele. The heterozygous mice, with a mixed C57BL/6 × 129
background, were bred to generate WT, Jdp2+/- and Jdp2-/-KO mice (KO) for subsequent
analyses. All work with animals was were performed in accordance with the guidelines
of the RIKEN BioResource Center, Japan, for the care and use of animals for scientific
purposes.
We constructed a targeting vector for the promoter and exon 1 of Jdp2
(Jdp2KOTV-2) (Supplementary Figure S7A) and used it to generate chimeric mice by
injecting clones of targeted ES cells into blastocytes from C57BL/6J mice. Chimeric
males were then mated with C57BL/6J females to produce an F1 generation. Intercrosses between heterozygotes yielded homozygous mutants at the expected ratio.
“Knock-out (KO)” mice carried a disrupted allele of the Jdp2 gene, in which a 3,048-bp
DNA fragment flanked by XbaI and PstI sites had been replaced by a cassette from
pGKpro-Neo-polyA.
This region includes three possible sites of initation of
3
J. Pan et al.
transcription (GenBank, AB034697, BC019780 and AB077438) of the Jdp2 gene
(Supplementary Figure S7A).
We confirmed that the promoter region of Jdp2 (the XbaI/BamHI DNA fragment)
had the full transcriptional activity of the Jdp2 gene in luciferase reporter assays with a
deletion series generated from the 5’ region of the Jdp2 gene (Supplementary Figure
S7B). We detected WT and mutated Jdp2 alleles by Southern blotting and PCR-based
genotyping. The genotype study also demonstrated that the F2 offspring produced by
mating heterozygous males and females conformed to Mendel’s law. One set of
representative results from 14 offspring is shown in the lower panel of Supplementary
Figure S7C.
We next performed Northern blotting and RT-PCR to confirm the expression of
JDP2 mRNA in various tissues. In WT mice, JDP2 mRNA was expressed in all organs
analyzed and was present at relatively high levels in lung, brain, spleen and kidney. By
contrast, JDP2 mRNA was un-detectable in Jdp2KO mice and a faster-migrating band,
which might correspond to an abbreviated form of JDP2 mRNA, was detected at a low
level in lung, brain and kidney (Supplementary Figure S8A). The results of an RT-PCR
assay with another set of samples confirmed the results of the Northern blotting assay
(Supplementary Figure S8B). Our data suggested that expression of JDP2 mRNA had
been disrupted in many organs of Jdp2KO mice, although some abbreviated JDP2
mRNA still remained in some tissues at quite a low level. We think that the generation
of these mRNAs might be due to the alternative promoters outside the exon 1 (data not
shown). We found no abnormalities with regard to body weight, reproduction and life
span in the Jdp2 hetero- or homo-KO mice under normal breeding conditions, with the
exception of tail length. The phenotype and behavior in our Jdp2 KO mice resembled
4
J. Pan et al.
that of the WT, but tails were shorter and the ratio of tail length to body length was
smaller than that of WT control mice. These observations were consistent with those
from KO mice with a defect in the coding region of the gene for JDP2 (exon 2 KO; data
not shown).
Skin wound-healing model and scratch-wounding assay
Jdp2KO male mice at 20-30 weeks of age (body weight, 30.3 ± 0.7 g) were used in skin
wound-healing assays, together with sex- and age-matched WT littermates (body weight,
29.5 ± 2.40 g). After shaving the dorsal hair and cleaning the exposed skin with 70%
ethanol, we made full-thickness excision skin wounds aseptically unit a 4-mm biopsy
punch. Each wound region was photographed digitally with a scale marker 1, 3, 6 and 911 days after wounding. The size of the unclosed wound bed was calculated with the
Image J program (version 1.36b; NIH, USA). Wounded mice were injected
intraperitoneally with 20 µl/g body weight of bromodeoxyuridine (BrdU) labeling
reagent (Roche Applied Science, Penzberg, Germany) on various days after wounding
and killed 2.5 h after injection. Paraffin-embedded sections were subjected to
hematoxylin-eosin staining and immunostaining with the BrdU Labeling and Detection
Kit I (Roche Applied Science). The cells that had incorporated BrdU at wound margins
were photographed under a fluorescence microscope with a digital camera system
(Olympus, Tokyo, Japan). The scratch-wounding assay in vitro was performed with
MEFs. Confluent monolayer of cells were then scratched linearly and incubated for a
few days in DMEM plus 15% FCS. Photographs were taken 12 to 60 h after scratching.
Analysis of cell cycle
MEFs were cultured at 5 x 105 cells per 10-cm dish or 2 x 104 cells per well in 24-well
plates, in triplicate, to estimate proliferation rates. Cells were counted by the trypan blue
5
J. Pan et al.
dye-exclusion test (Invitrogen, Carlsbad, CA, USA) or after application of the Alamar
Blue reagent (Alamar Biosciences, Sacramento, CA, USA) according to the
manufacturers’ instructions. For analysis of the cell cycle, serum-starved MEFs were
further cultured in DMEM that contained 15% FCS and collected at the indicated times.
Harvested cells were stained with propidium iodide (PI; 1 µg/ml), and subjected to
fluorescence-activated analysis of DNA content in a flow cytometer EPICS XL-MCL;
Beckman Coulter, Miami, FL, USA). To count cells that had entered the S-phase from
the G1-or G0-phase at higher sensitivity, we performed a BrdU-incorporation assay in
vitro with the BrdU Labeling and Detection Kit I. Serum-starved MEF were seeded at 1
x 105 cells per chamber on chamber slides in DMEM plus 15% FCS. After 12 h, cells
were pulse-labeled for 3 h with 10 µM BrdU and the BrdU incorporated into cells was
detected by immunocytochemical staining with antibodies against BrdU and
fluoresceine-conjugated second antibodies, together with staining with PI for
localization of nuclei. For the colony-formation assay, MEFs were plated in duplicate
at 5 x 102 or 5 x 103 cells per 10-cm gelatin-coated dish. After two weeks, colonies with
diameters greater than 2 mm were counted after staining with Giemsa staining solution
(Wako Chemicals, Co., Tokyo, Japan).
Isolation of RNA, microarrays, and real-time quantitative RT-PCR
Total RNA was extracted from various tissues of both Jdp2KO and WT adult mice,
from embryos and from corresponding MEFs with Trizol (Invitrogen) according to the
manufacturer’s instructions. Expression of JDP2 mRNA was analyzed by Northern
blotting as described elsewhere (Jin et al., 2002). For microarray analysis, total RNA (5
µg) was converted to cRNA with aminoallyl-UTP and fluorescence-labeled with a lowinput RNA linear amplification kit (Agilent Technologies, Inc., Santa Clara, CA USA)
6
J. Pan et al.
and Cy3- or Cy5-labeled CTP (PerkinElmer, Waltham, MA, USA). Samples of Cy3labeled WT RNA and Cy5-labeled JDP2-deficient RNA (750 ng) were combined in
equal amounts and allows to hybridize to a microarray (Agilent Mouse Oligonucleotide
Array, 22,000 features, Agilent Technologies Inc.) for 17 h at 60 °C, with subsequent
washing, drying and storage under nitrogen in darkness. Hybridization signals recorded
with a microarray scanner (Agilent) were normalized and corrected for background
signals (with Agilent Feature-Extraction software). Real-time quantitative RT-PCR
(qRT-PCR) was performed with a PRISM™ 7700 system (Amersham Biosystems,
Foster City, CA, USA) according to the manufacturer’s instructions. We designed the
primers using the public-domain Primer 3 program of GENETYX-Mac Ver.14 software
(Hitachi Software, Tokyo, Japan). The respective pairs of primers were listed in
Supplementary Table 2.
Recombinant virus infection and siRNA
Replication-defective adenovirus that encoded JDP2 (Ad-JDP2) and -galactosidase
(Ad-cont) were generated from pAxCAwt, as described elsewhere (RIKEN DNA Bank;
Miyake et al., 1996, Ugai et al., 2005). For preparation of lentivirus, 293T cells in 10cm
dishes were transfected with a DNA mixture of 5 g of pCAG-HIVgp and pCMV-VSVG-RSV-Rev as packaging vectors and 10 g of either CSII-CMV-MCS-IRES2-Bsd or
CSII-CMV-MCS-IRES2-Bsd-JDP2 as expression vectors. For shRNA expression, 10
g of pLKO.1 or pLKOshp53 was used instead of an expression vector. After three
days incubation, the supernatant was harvested and stored at -80 oC as a lentivirus
solution. In the case of siRNA, 4 x 104 WT and Jdp2KO MEFs at 60% confluence were
transfected with 20 pmole of control siRNA (45-2002; lot 360646; Invitrogen, Carlsbad,
7
J. Pan et al.
CA, USA) and two siRNAs (#1 and #2; Nakade et al., 2009) against JDP2 according to
the manufacturer’s instruction (Amgene Inc., Thousand Oaks, CA, USA).
Cell proliferation and apoptosis
Jdp2KO MEFs cultured in a 3% O2 and 5% CO2 incubator were infected with lentivirus
for the expression of JDP2 or its control empty vector together with lentivirus for the
expression of p53 shRNA or its control empty vector. After two days incubation, the
infected cells were selected in the presence of 10 μg/ml blasticidin and 2 μg/ml of
puromycin and cultured for one week in the presence of 3% O2. For cell proliferation
assay, the cells were plated and cultured for three days in the presence of environmental
oxygen (20%) followed by treatment with 10 μM 5-ethynyl-2-eoxyuridine (Edu) for 7
h. The growing and total cells were stained with Alexa Fluorazide and Hoechst,
respectively, using a Click-iT EdU Assay Kit (C10337, Invitrogen) and photographed
by fluorescent microscopy. The average percent of growing cells was calculated by
dividing the number of growing cells by the total cells. The numbers of growing and
total cells are generated by counting in five different pictures using CellCount.ver.1.1.7.
software.
In the case of apoptosis, we irradiated cells with UVC at 20-60 J/m2 using a UV
Cross Linker (model 1800; Stratagene, La Jolla, CA, USA) and then incubated cells for
24 h at 37 °C, or we treated cells with inducers of cell death (Apoptosis Inducer Set;
Millipore, Billerica, MA, USA) which included actinomycin D (10 μM), camptothecin
(2 μM), cycloheximide (100 μM), dexamethasone (100 μM), and etoposide (100 μM)
for 24 h. Since members of the cysteine/aspartic acid-specific protease (caspase) family
play key roles in apoptosis, we assessed the activities of caspase 3 and caspase 7 using
the Caspase-Glo 3/7 Assay kit (Promega). Living cells were also quantitated by the
8
J. Pan et al.
trypan blue dye-exclusion assay and analyzed by flow cytometry for identification of
the sub-G1 population of cells.
Electrophoretic mobility shift assays (EMSAs)
All EMSAs were performed as described elsewhere (Jin et al., 2001), with slight
modification. Nuclear extracts (NEs) were prepared from WT and Jdp2KO MEFs,
which had been incubated in DMEM (serum-free or plus 10% FCS) for 24 h. DNA
probes with the respective elements in the promoter of the gene for cyclin A were as
follows (sense stand: AP-1 like, 5'- CACTACATAGCTGACTTGGACTAACTTGAA3' (nt -843 to -814); AP-1, 5'-GGATATCAGTGAGTCACAGGACAATTGGGA-3' (nt
-525 to -496); AP-1 mutant, 5'-GGATATCAGTGAaTaACAGGACAATTGGGA-3';
CRE, 5’-GGCGCTTCTGGTGACGTCACGGACTCCGGA-3’ (nt -66 to -37); and CRE
mutant, 5’-GGCGCTTCTGGTGAaaTCACGGACTCCGGA-3’ (underlining indicates
consensus protein-binding sites). Super-shift assays were performed by additional
incubation with appropriate antibodies for 20 min prior to electrophoresis. Antibodies
were used for JDP2 (249 monoclonal antibody, see below), c-Jun (H-79, sc-1694X), Jun
B (N-17, sc-46X), Jun D (329, sc-74X), ATF2 (N-96, sc-62339X), E2F1 (KH95, sc251X) and c-Fos (4, sc-52X) (all from Santa Cruz Biotechnology Inc., Santa Cruz, CA,
USA).
Immunoprecipitation (IP) and IP-Western blotting
Whole-cell extracts were prepared from MEFs in RIPA buffer, and Western blotting
and IP-Western blotting were performed as described previously (Jin et al., 2002) with
antibodies against following proteins, cyclin A2 (C-19; sc-596), cyclin E2 (A-9, sc28351), cdk2 (D-12; sc-6248, 0.N.198; sc-70829) and -actin (I-19; sc-1616) form
Santa Cruz Biotechnology; and cyclin D1 (Cnd1; DCS6; #2926). Cyclin D3 (Cnd3,
9
J. Pan et al.
DCS22; #2936), cdk4 (DCS156; #2906), Cdk6 (DCS83: #3136), p53 (#9282),
phosphor-Rb (Ser 795; #9301), p21 (DCS60; #2946); and cyclin B1 (GTX100911),
cyclin A2 (GTX103042), cyclin D1 (GTX112874) and cdk1 (GTX108120) from
GeneTex, Inc. (Irvine, CA, USA); cyclin E2 (600-401-971) from Rockland
Immunochemicals (Gilbertsville, RA, USA); and cyclin D1 (Cnd1, DCS6;#2926),
cyclin D3 (Cnd3, DCS22; #2936), cdk4 (DCS156; #2909), cdk8 (DCS83; #3136), p53
(#9282), Phospho-Rb (Ser 795; #9301), p21 (DCS60; #2946) and c-Jun (#9162) from
Cell Signaling Technology (Beverly, MA, USA), respectively. Monoclonal antibodies
against JDP2 (176 and 249), described elsewhere (Jin et al., 2002), and polyclonal
JDP2-specific antibodies (kindly provided by Dr. A. Aronheim, Israel) were used as
first antibodies in Western blotting analysis, as described previously (Nakade et al.,
2007). To detect proteins associated with Cdk2 or Cdk1, we immunoprecipitated Cdks
from whole-cell extract with an antibody specific for Cdk2 (D-12; sc-6248) or cdk1
(GTX108120) and protein A-, G-Sepharose (Pharmacia, Uppsala, Sweden). We
subjected eluted proteins to SDS-PAGE (10% polyacrylamide) and performed Western
blotting with antibodies specific for cyclin A2 and Cdk2 (in the case of Cdk2,
immunoprecipitates were mixed with a non-reducing sample buffer).
Chromatin immunoprecipitation (ChIP) assay
ChIP assays were performed with a kit according to the manufacturer's instructions
(ChIP assay kit; Upstate Biotechnology Co., Lake Placid, NY, USA). Semi-confluent
MEFs cultured in serum-free DMEM or DMEM plus 10% FCS were cross-linked by
treatment with 1% formaldehyde, lysed and sonicated to shear DNA to an average
length of approximately 600 bp. Immunoprecipitations were performed with an
antibody specific for JDP2 (as in the EMSAs described above) and antibodies specific
10
J. Pan et al.
for acetyl-histone H4 (06-866; Upstate Biotechnology Co.). Immunoprecipitated
fragments of DNA were analyzed by semi-quantitative PCR with specific primers for
5’-flanking regions of genes for cyclin A2, cyclin E2 and p16Ink4a (see Supplementary
Table 2).
Immunofluorescence
HeLa cells
were cultured in Iscove’s modified Dulbecco’s medium containing 1%
fetal bovine serum and 4% bovine serum at 37oC. After in situ treated with 0.5% Triton
X-100 at 4oC for 3 min, cells were fixed in 4% paraformaldehyde for 20 min and
permeabilized in phosphate-buffered saline containing 0.1% saponin and 3% bovine
serum albumin at room temperature (Takahashi et al., 2009). Cells were stained with
monoclonal anti-JDP2 antibody (cl. 249, 176) and/or polyclonal anti-cyclin A antibody
(United Biomedical Inc., Haupauge, NY, USA; cat. no. 06-138) for 90 min, washed
with phosphate-buffered saline (PBS) containing 0.1% saponin, and then stained with
FITC- and/or TRITC-conjugated secondary antibodies for 1 h. For DNA staining, cells
were treated with 200 µg/ml RNase A for 30 min and 10 ng/ml TOPRO-3 for 30 min.
Stained cells were mounted with ProLongTM antifade reagent (Molecular Probes,
Eugene, OR, USA). Confocal and Nomarski differential interference contrast images
were obtained using an FV500 laser scanning microscope (Olympus, Tokyo, Japan), as
described previously (Ikeda et al., 2008). One planar (xy) section slice images with 1.5µm thickness were shown. To ensure that there was no bleed through from the FITC
signal into the red channel, FITC and TRITC were independently excited at 488 nm and
543 nm respectively. Emission signals were detected between 505 and 525 nm for FITC
and between 560 and 600 nm for TRITC. TOPRO-3 was excited at 633 nm and its
11
J. Pan et al.
emission signal was detected more than 660 nm. Composite figures were prepared using
Photoshop 5.0 and Illustrator 9.0 softwere (Adobe).
References
Heinemeyer
T,
Wingender
E,
Reuter H, Hermjakob
RH,
Kel
AE,
Kel
OV et al. (1998). Databases on transcriptional regulation: TRANSFEC, TRRD and
COMPEL. Nucleic Acids Res 26: 362-367.
Ikeda K, Nakayama Y, Togashi Y, Obata Y, Kuga T, Kasahara K et al. (2008). Nuclear
localization of Lyn tyrosine kinase mediated by inhibition of its kinase activity. Exp
Cell Res 314: 3392-3404.
Jin C, Li H, Murata T, Sun K, Horikoshi M, Chiu R et al. (2002). JDP2, a repressor of
AP-1, recruits a histone deacetylase 3 complex to inhibit the retinoic acid-induced
differentiation of F9 cells. Mol Cell Biol 22: 4815-4826.
Miyake S, Makimura M, Kanegae Y, Harada S, Sato Y, Takamori K et al. (1996).
Efficient generation of recombinant adenoviruses using adenovirus DNA-terminal
protein complex and a cosmid bearing the full-length virus genome. Proc Natl Acad
Sci USA 93: 1320-1324.
Nakade K, Pan J, Yoshiki A, Ugai H, Kimura M, Liu B et al. (2007). JDP2 suppresses
adipocyte differentiation by regulating histone acetylatyion. Cell Death and Differ
14: 1398-1405.
Niwa H, Miyazaki J, Smith AG. (2000). Quantitative expression of Oct-3/4 defines
differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet 24: 372-376.
12
J. Pan et al.
Takahashi A, Obata Y, Fukumoto Y, Nakayama Y, Kasahara K, Kuga T et al. (2009).
Nuclear localization of Src-family tyrosine kinases is required for growth factorinduced euchromatinization. Exp Cell Res 315: 1117-1141.
Tybulewicz VL, Crawford CE, Jackson PK, Bronson RT, Mulligan RC. (1991).
Neonatal lethality and lymphopenia in mice with a homozygous disruption of the cabl proto-oncogene. Cell 65: 1153-1163.
Ugai H, Yamasaki T, Hirose M, Inabe K, Kujime Y, Terashima M et al. (2005).
Purification of infectious adenovirus in two hours by ultracentrifugation and
tangential flow filtration. Biochem Biophys Res Comm 331: 1053-1060.
Figure legends
Supplementary Figure S1
Assays of skin-wound healing to compare the healing of skin between WT and Jdp2KO
mice (12 mice). Male six C57/BL6J mice were injured by excising full-thickness skin
(a disk of 4 mm in diameter) from their shaved backs. In control WT six male mice, reepithelialization was complete within 11 to 13 days after injury. In the case of Jdp2KO
mice, the skin seemed to re-epithelialize rapidly within 10 to 11 days. (A) Recovery of
skin wounds was examined by macroscopic observation of the wounded skin on days 1,
3, 6 and 10 after injury. (B) We measured the area of the wound in each case and found
that wound repair was accelerated in Jdp2KO mice. (C) In order to compare the
proliferative potential of cells after tissue injury in Jdp2KO and WT mice, we labeled
wound mice with bromodeoxyuridine (BrdU) in vivo. Wounded mice were injected
intraperitoneally with BrdU at 0, 1, 3 and 6 days after wounding and sacrificed 2.5 h
after injection. Samples of skin wounds were excised for the preparation of paraffin-
13
J. Pan et al.
embedded sections, which were subjected to immunostaining with antibodies against
BrdU (S-Figure 3C). We found large numbers of BrdU-positive endothelial cells and
fibroblasts at wound margins, and the numbers of BrdU-positive cells at wound margins
in Jdp2KO mice were 3.5-fold higher than in WT mice. Thus, enhancement of cell
proliferation in Jdp2KO mice apparently contributed to enhanced repair of wounds. (D)
Levels of mRNAs for PCNA, Col1a1 and cyclin A2 were higher in the skin of Jdp2KO
mice than in that of WT mice 1, 3 and 6 days after injury. Thus, JDP2 was clearly
involved in the expression of growth-related genes, such as those for PCNA, Col1a1
and cyclin A2.
Supplementary Figure S2
Apoptosis in MEFs from WT and Jdp2KO mice. (A) MEFs from WT and Jdp2KO
mice were exposed to UVC at 20-60 J/m2 and incubated for 24 h. The percentage of
dead cells was determined by trypan blue staining. (B) MEFs from WT and Jdp2KO
mice were cultured in DMEM plus 0.1% FBS and 10% FBS with or without exposure
to UVC (60 J/m2) and incubated for 24 h. Then the activities of caspases 3 and 7 were
measured.
(C) MEFs were exposed to UVC at 20 J/m2, incubated for another 24 h,
stained with PI and subjected to FACS analysis to determine the percentage of cells in
the sub-G1 population. (D) 2 x 105 MEFs from WT and Jdp2KO mice were treated with
the indicated inducers of cell death, as described in Materials and Methods, for 24 h.
Then activities of caspases 3 and 7 were measured with a Caspase-Glo 3/7 assay kit
(Promega).
Supplementary Figure S3
14
J. Pan et al.
Exposure to UVC suppressed the expression of JDP2. MEFs (5 x 105) were exposed to
UVC (60 and 600 J/m2) and incubated for 2 h and 8 h. Total RNA was extracted from
MEF and blotted with a JDP2-specific probe. RNA blots of GPDH mRNA and of 28S
and 18S rRNA, were included as controls.
Supplementary Figure S4
ChIP assays with acetyl H4 of lysates of WT and Jdp2KO MEFs. Precipitated
fragments of DNA were detected by PCR with primers specific for the promoter of the
endogenous gene for cyclin A2, as described in the legend to Figure 5C.
Supplementary Figure S5
Inhibition of cell growth by JDP2 in p53 knock-down MEF. (A) Fluorescent
microscopy of growing JDP2 and shp53 double-infected cells. JDP2-/- MEF were
infected with lentivirus for the expression of JDP2 or its control empty vector together
with the expression vector of p53 shRNA or its control empty vector. After one week of
selection under low oxygen conditions (3% O2) and three days of further incubation at
environmental oxygen condition (20% O2), the cells were treated with 10 M EdU for 7
h. The growing and total cells were stained by Alexa Fluor azide and Hoechst,
respectively. (B) The percentage of growing cells. The number of growing cells and
total cells in five different fluorescent microscopic views was counted. The average
percentages of growing cells are shown. (C) Downregulation of endogenous p53 by
shRNA. Total RNA was extracted and subjected to real-time RT-PCR for quantitation
of transcripts specific for p53. Levels of expression were normalized by reference levels
of transcripts of the GPDH gene.
Supplementary Figure S6
15
J. Pan et al.
Localization of JDP2 and cyclin A in the nucleus. HeLa cells were doubly stained with
anti-JDP2 or anti-cyclin A antibody and TOPRO-3 (for DNA), and triply stained with
anti-JDP2 and cyclin A antibodies and TOPRO-3. Scale bars, 5 µm. The resulting red
emission of TOPRO-3-stained nuclei is pseudo-colored as blue.
Supplementary Figure S7
Targeted disruption of the Jdp2 gene and a summary of the expression of Jdp2 in mice.
(A) The wild-type (WT) Jdp2 allele and the mutated allele are indicated. Exons 1a, 1b
and 1c (3,048 bp; white boxes) were replaced by a PGK-neomycin resistance gene
(PGK-Neo casset; gray box) in the mutated allele. Exons 2, 3 and 4 (black boxes) and
the sites of restriction enzymes are shown. (B) Relative luciferase activities of Jdp2
promoter-reporter constructs. A 4,211-kbp fragment of the upstream promoter region of
the Jdp2 gene was ligated into the pGL3-Basic vector to generate a Jdp2 promoterluciferase gene and a series of deleted derivatives (HindIII/BamH1, Xba1/BamH1,
HindIII/Sac1-Sma1/BamH1, Sma1/BamH1 and control vector). 5 x 104 cells were
transfected with 1 µg of a promoter-reporter construct and the pGL3-control vector (for
normalization; luciferase activity = 1.0). Cells were harvested 30 h after transfection for
assays for luciferase activity. Values are from a representative experiment and are given
as means ± S. E. (n=3).
(C) Genotyping by Southern blotting and genomic PCR.
Southern blotting revealed a band of 3.4 kb in the case of wild-type Jdp2 gene and of
4.7 kb in the case of the correctly targeted allele. The positions and sequences of the
primers for genomic PCR are described elsewhere (Nakade et al., 2007). Mutant and
WT alleles yielded amplified products of 788 and 503 bp, respectively.
Supplementary Figure S8
16
J. Pan et al.
Northern blotting and RT-PCR assays to examine the expression of JDP2 in various
organs from WT and Jdp2KO mice and in F9 cells. (A) The expression of mRNAs for
JDP2 and -actin in various organs from WT and Jdp2KO mice, as well as in F9 cells
(Jin et al, 2002) is examined. The amounts of mRNA loaded were adjusted relative to
the amount of 28S rRNA. JDP2 short indicates shorter transcript of JDP2. (B) The
expression of mRNAs for JDP2 and GPDH in various organs of WT and Jdp2KO mice
was determined by RT-PCR (35 cycles for JDP2 mRNA and 20 cycles for GPDH).
Supplementary Table 1
Microarray analysis of gene expression in Jdp2KO MEFs. A comparison of the
expression of potential target genes of JDP2 and cell cycle-related genes in WT MEF
and Jdp2KOMEF is shown.
Supplementary Table 2
Summary of sequences of oligodeoxynucletide primers used in this study is shown.
17