Raake et al., AAV6.(ARKct gene therapy for clinically relevant heart failure
ONLINE SUPPLEMENT
Generation of adeno-associated viral vectors
A novel βARKct-cDNA optimized for human codon usage was generated (Geneart, Regensburg,
Germany) and inserted into pdsCMV-MLC0.26-EGFP after excision of the EGFP reporter with
BamHI/BsrGI resulting in an AAV genome plasmid with a codon-optimized βARKct-cDNA under
transcriptional control of a CMV-enhanced myosin light chain (CMV-MLC) 0.26kb promoter
(pdsCMV-MLC0.26-βARKct) 1. High titer vectors were produced with a double transfection
approach of 293T cells in cell stacks® (Corning, Munich, Germany) using polyethylenimine as
described before
2-4
. For production of AAV6.βARKct, pDP6 providing the AAV-6 cap sequence
as well as adenoviral helper sequences 2, was cotransfected with the AAV vector genome
plasmid pdsCMV-MLC0.26-βARKct. Subsequently, vectors were harvested after 48h, purified by
Iodixanol step gradient centrifugation 3, and quantitated using real-time PCR as reported before
5
. AAV6.luciferase and AAV6.EGFP control vectors were produced analogous using pUFCMV-
MLC1.5-Luc 2 and pdsCMV-MLC0.26-EGFP 1.
Study protocol
The present investigation was carried out according to the ‘Guide for the Care and Use of
Laboratory Animals’ and was approved by the Animal Care and Use Committee of the state of
Baden-Württemberg. Ischemic cardiomyopathy/HF was created by LCX MI. Two weeks later
baseline cardiac function was determined (hemodynamics, echocardiography under basal and
catecholamine-stressed conditions and blood sample collection for biomarker assessment) and
animals were treated with AAV6.βARKct or AAV6.luciferase as control. 42 days later/56 days
after MI, cardiac function was determined (hemodynamics under basal and catecholaminechallenging conditions, echocardiography, as well as blood sample collection for biomarker
assessment). Animals were euthanized for standardized autopsy. Tissue samples were
collected for molecular analyses.
Raake et al., AAV6.(ARKct gene therapy for clinically relevant heart failure
Model of post-MI systolic HF
German farm pigs (n= 20 myocardial infarction, n= 11 sham (303kg) were anaesthetized and
monitored as described previously 1. A catheter introducer sheath was placed in the right carotid
artery and a 7F guiding catheter was placed in the ostium of the left coronary artery. A
percutaneous transluminal coronary angioplasty (PTCA) balloon (3.0x12mm) was placed via a
0.014” guiding wire at the beginning of the LCX and inflated at 14 atm. Occlusion of the LCX was
confirmed by coronary angiography and ST-segment changes in the ECG. After 2h of LCX
occlusion all catheters and introducer sheaths were removed and the animal was allowed to
recover. Sham animals were treated in the same manner except balloon occlusion of the LCX.
Characterization of the post-MI HF model and assessment of MI size
A subset of animals (n=3 animals/Sham group and n=3 animals/MI group) was used to
characterize the model of ischemic cardiomyopathy. 4 consecutive days post MI hsTnT was
measured
in
peripheral
electrochemiluminescence
venous
blood
immunoassay
samples
(Roche
using
Diagnostics,
an
hsTnT
Mannheim,
quantitative
Germany).
Furthermore, size of LV infarction following MI was assessed by the use of 2,3,5triphenylterazolium chloride (TTC) as described elsewhere
11
. 4 days after MI the hearts were
removed under general anesthesia and LVs were sliced into 1cm thick sections perpendicular to
the long axis of the heart. The slices were stained with 1% TTC and digitally photographed.
Infarcted area of the LV (TTC-negative stained tissue) and non-infarcted myocardium (TTCpositive stained tissue) was measured using Sigma Scan software (Aspire Software
International, Ashborn, Virginia, USA) and the MI size was expressed as a percentage of total
LV area.
Raake et al., AAV6.(ARKct gene therapy for clinically relevant heart failure
Gene transfer using retrograde injection into the coronary veins
Two weeks post MI the animal was anaesthetized again, intubated and catheter introducer
sheaths were placed in the right carotid artery and the right internal jugular vein. Blood samples
were collected and evaluation of cardiac function was carried out (echocardiography and
hemodynamics). For selective retrograde injection, the anterior interventricular vein (AIV) was
catheterized using a 6F retroinfusion catheter
6-10, 12-15
. In all animals a 7F guiding catheter was
placed in the left coronary artery and the LAD was wired. During retrograde delivery of the AAV
vectors the LAD was occluded by a PTCA balloon distal to the first diagonal branch in all groups.
Animals were randomized to treatment (n=10 control virus AAV6.Luciferase and n=10
AAV6.ARKct). AAV6 vectors (1E13 vg’s per animal) were diluted in 50 ml of 0.9% saline
solution supplemented with 0.5mg of substance P (Sigma Aldrich, St. Louis, Missouri, USA) and
6 mg adenosine (Sanofi-Aventis, Frankfurt, Germany) resulting in a total volume of 51 ml which
was subsequently divided in three portions of 17 ml. 17 ml of the vector solution was injected
into the AIV over 3 min while the balloon at the tip of the retroinfusion catheter was inflated to
block venous outflow and the PTCA balloon in the LAD was inflated to block arterial inflow.
Injections were repeated twice with each 17 ml vector solution for 3 min after deflating both
balloons for 3 min to allow reflow. At the end of the experiment all catheters and introducer
sheaths were removed and the animals were allowed recovering.
Final measurements and sample harvesting
42 days after gene delivery/56 days post MI animals were anaesthetized again, intubated and
catheter introducer sheaths were placed in the right carotid artery and the right internal jugular
vein. Blood samples were collected. After in vivo measurements (echocardiography and
hemodynamics) animals were euthanized by injection of 20mmol potassium (Sigma Aldrich, St.
Louis, Missouri, USA) and cardiac and extracardiac organ samples harvested.
Raake et al., AAV6.(ARKct gene therapy for clinically relevant heart failure
Echocardiographic and hemodynamic analysis of cardiac function
Global LV hemodynamics (Millar Instruments, Houston, Texas, USA) measurements were
performed with a closed chest approach at baseline and after increasing doses of dobutamine to
assess global LV function (Sigma-Aldrich, St. Louis, Missouri, USA). LV function was assessed
by transthoracic echocardiography due to anatomical reasons in a lateral short axis view (lateral
short axis M-Mode through septal and lateral wall) (Sonos 7500, Philips, Hamburg, Germany);
by this method regional LV function and reversed remodeling was assessed in non-targeted LV
areas.
RNA isolation, reverse transcription and quantitative real-time RT-PCR
Total RNA was isolated from myocardial tissue samples from the non-infarcted targeted (LAD-)
area using the Ultraspec method (Biotecx Laboratories Inc., Houston, Texas, USA) according to
the manufacturer’s protocol. An aliquot of each sample was run on a denaturing agarose gel
(1%) to assess the quality of RNA. cDNA synthesis was performed on 1 µg of total RNA by the
use of the iScript cDNA Synthesis Kit (BioRad Laboratories, Hercules, California, USA). Finally,
2.5 µl of diluted cDNA (1/100) was added to a 15 µl mixture that contained a 1 concentration of
iQ SYBR Green Supermix (BioRad Laboratories, Hercules, California, USA) and 100 nM of
gene-specific oligonucleotides. Quantitative PCR was carried out on a MyiQ Single-Color RealTime PCR detection system (BioRad Laboratories, Hercules, California, USA) for ANF (FWD
GCGAACCCTGTGTACGGCTCC,
REV
CCCCGGTCCAGGGAGGTACC),
-MHC
(FWD
GACGAGGCCGAGCAGATCGC, REV CGGCTCTTGGCCCGAAGCTT), Collagen 1 alpha 1
(FWD GGCTCCTGCTCCTCTTAGCG, REV AGGGCACGGGTTTCCACACG), Collagen 3 alpha
1 (FWD GATGGTTGCACTAAACACACTG, REV GTCACTTGTACTGGTTGACAAG) and 18S
(FWD,
levels.
TTCACTGTACCGGCCGTGCG,
The
annealing
temperature
REV
was
CTGTCACCGCCCTGCAAGCA)
set
to
62.3ºC.
PRIMER3
expression
software
Raake et al., AAV6.(ARKct gene therapy for clinically relevant heart failure
(http://frodo.wi.mit.edu/) was used to generate sequence-specific oligonucleotide primers
(Sigma-Aldrich, St. Louis, Missouri, USA) based on cDNA sequences in the National Center for
Biotechnology database.
Following each run a melting curve was acquired by heating the
product to 95°C, cooling to and maintaining at 55°C for 20 seconds, then slowly (0.5°C/s)
heating to 95°C, to determine the specificity of the PCR products.
Western blot analysis
Western blotting was performed as described previously
11
. Cardiac protein levels of GRK2 and
ARKct (sc-562, C-15, Santa Cruz Biotechnology, 1:5,000), and GAPDH (clone 6C5, Millipore,
Billerica, Massachusetts, USA) were assessed in cardiac myocyte cellular preparations. Protein
content was quantified with the BioRad DC Protein Assay (BioRad Laboratories, Richmond,
California, USA).
Protein samples were separated by 4-20% SDS-PAGE (Invitrogen
Corporation, Carlsbad, California, USA), and proteins were transferred to PVDF membrane
(Millipore Corporation, Billerica, Massachusetts, USA) and probed with the first antibody at 4°C
overnight. The proteins were stained with a corresponding Alexa Fluor 680- (Molecular Probes;
1:10.000) or IRDye 800CW-coupled (Rockland Inc.; 1:10.000) secondary antibody, followed by
visualization of the proteins with a LI-COR infrared imager (Odyssey, LI-COR, Lincoln,
Nebraska, USA), and quantitative densitometric analysis was performed applying Odyssey
version 2.0 infrared imaging software.
Determination of metanephrine, normetanephrine and BNP plasma levels
Plasma metanephrines and normetanephrines were analyzed by an enzyme immunoassay (EIA)
(LDN Labor Diagnostika Nord GmbH, Hamburg, Germany). Plasma BNP levels were determined
using the porcine BNP-32 EIA (Phoenix Pharmaceuticals inc, Burlingame CA, USA).
Raake et al., AAV6.(ARKct gene therapy for clinically relevant heart failure
β-adrenergic receptor density - radioligand binding assay
Membrane proteins from left ventricular myocardium were prepared as previously described for
heart tissue 16. In brief, 500 mg heart tissue was homogenized in ice cold lysis buffer (5mM TrisHCl, 2 M EGTA, pH 7,5 ) Nuclei and mitochondria were removed by centrifugation at 1500 g for
20 min. Supernatant (final membranes and cytosolic proteins) were centrifuged at 20,000 g for
2h at 4°C. The Pellet (membranes) was resuspended by needle and syringe in resuspension
buffer (5mM Tris-HCl, 12,5 mM MgCl2, 2 mM EGTA, 20 mg/ml aprotinin, and 1 mm
phenylmethylsulfonyl PMSF). Total β-AR-density was determined by standard radio ligand
binding techniques using the non-selective radiolabeled β-AR ligand [125I]- cyanopindolol (125ICYP) (Perkin Elmer, Waltham, Massachusetts, USA). Ligand binding assays were performed in
duplicates on membranes and the reaction mixture consisted of 1 mg/ml membrane suspension,
5-600 pM 125I-CYP and unlabeled β-antagonist CGP12177 (100 µM) (Tocris Bioscience,
Ellisville, Missouri, USA). The whole reaction mixture was incubated in a polypropylene tube for
90 min at 37 °C. After adding washing buffer, the mixture was rapidly vacuum filtered trough a
Whatman GF/B filter (Whatman GmbH, Dassel, Niedersachsen, Germany). Each filter was
washed with 16 ml washing buffer and counted in a gamma counter (Multi Crystal LB 2111, Bad
Herrenalb, Baden-Württemberg, Germany). Specific β-AR binding was determined from the
difference between total binding in the absence of CGP12177 and nonspecific binding in the
presence of CGP12177. The total β-AR receptor density (Bmax) was determined (using
GraphPad software), and receptor density was normalized to milligrams of membrane protein.
Direct immunofluorescence of transgene expression
To visualize transgene distribution after retrograde gene delivery we treated an additional sham
animal with retrograde delivery of AAV6-MLC2vCMVenh-luciferase/Green Fluorescent Protein
(GFP) into the anterior interventricular vein. 6 weeks post gene delivery the heart was dissected
and samples from the targeted (LAD-) and non-targeted (LCX-control) area were fixed for four
Raake et al., AAV6.(ARKct gene therapy for clinically relevant heart failure
hours at 4°C in PBS containing 0,1% glutaraldehyde/ 1,5% paraformaldehyde/ 20% sucrose,
embedded in Tissue Freezing Medium (Leica, Bensheim, Germany), and slowly frozen to -20°C.
To determine myocardial reporter gene distribution, 10µm transversal section have been cut and
evaluated for EGFP expression by fluorescence microscopy (Nikon Eclipse 90i upright
automated microscope, Düsseldorf, Germany) using a D1QM camera (Nikon, Düsseldorf).
Optical overview images were obtained by the scan large image function of the microscope.
References:
1.
Müller OJ, Schinkel S, Kleinschmidt JA, Katus HA, Bekeredjian R. Augmentation of AAV-mediated
cardiac gene transfer after systemic administration in adult rats. Gene Ther 2008;15(23):1558-65.
2.
Müller OJ, Leuchs B, Pleger ST, Grimm D, Franz WM, Katus HA, Kleinschmidt JA. Improved
cardiac gene transfer by transcriptional and transductional targeting of adeno-associated viral vectors.
Cardiovasc Res 2006;70(1):70-8.
3.
Hauswirth WW, Lewin AS, Zolotukhin S, Muzyczka N. Production and purification of recombinant
adeno-associated virus. Methods Enzymol 2000; 316: 743–761.
4.
Reed SE, Staley EM, Mayginnes JP, Pintel DJ, Tullis GE. Transfection of mammalian cells using
linear polyethylenimine is a simple and effective means of producing recombinant adeno-associated virus
vectors. J Virol Methods. 2006;138(1-2):85-98.
5.
Veldwijk MR, Topaly J, Laufs S, Hengge UR, Wenz F, Zeller WJ, Fruehauf S. Development and
optimization of a real-time quantitative PCR-based method for the titration of AAV-2 vector stocks. Mol
Ther 2002;6(2): 272–278.
6.
Raake PW, Hinkel R, Muller S, Delker S, Kreuzpointner R, Kupatt C, Katus HA, Kleinschmidt JA,
Boekstegers P, Müller OJ. Cardio-specific long-term gene expression in a porcine model after selective
pressure-regulated retroinfusion of adeno-associated viral (AAV) vectors. Gene Ther 2008;15(1):12-7.
7.
Raake P, von Degenfeld G, Hinkel R, Vachenauer R, Sandner T, Beller S, Andrees M, Kupatt C,
Schuler G, Boekstegers P. Myocardial gene transfer by selective pressure-regulated retroinfusion of
coronary veins: comparison with surgical and percutaneous intramyocardial gene delivery. J Am Coll
Cardiol 2004;44(5):1124-9.
8.
von Degenfeld G, Raake P, Kupatt C, Lebherz C, Hinkel R, Gildehaus FJ, Munzing W, Kranz A,
Waltenberger J, Simoes M, Schwaiger M, Thein E, Boekstegers P. Selective pressure-regulated
retroinfusion of fibroblast growth factor-2 into the coronary vein enhances regional myocardial blood flow
and function in pigs with chronic myocardial ischemia. J Am Coll Cardiol 2003;42(6):1120-8.
9.
Boekstegers P, Peter W, von Degenfeld G, Nienaber CA, Abend M, Rehders TC, Habazettl H,
Kapsner T, von Ludinghausen M, Werdan K. Preservation of regional myocardial function and myocardial
oxygen tension during acute ischemia in pigs: comparison of selective synchronized suction and
retroinfusion of coronary veins to synchronized coronary venous retroperfusion. J Am Coll Cardiol
1994;23(2):459-69.
10.
Raake P, Hinkel R, Kupatt C, von Bruhl ML, Beller S, Andrees M, Vicol C, Boekstegers P.
Percutaneous approach to a stent-based ventricle to coronary vein bypass (venous VPASS): comparison
Raake et al., AAV6.(ARKct gene therapy for clinically relevant heart failure
to catheter-based selective pressure-regulated retro-infusion of the coronary vein. Eur Heart J
2005;26(12):1228-34.
11.
Most P, Seifert H, Gao E, Funakoshi H, Volkers M, Heierhorst J, Remppis A, Pleger ST,
DeGeorge BR, Jr., Eckhart AD, Feldman AM, Koch WJ. Cardiac S100A1 protein levels determine
contractile performance and propensity toward heart failure after myocardial infarction. Circulation
2006;114(12):1258-68.
12.
Boekstegers P, Giehrl W, von Degenfeld G, Steinbeck G. Selective suction and pressureregulated retroinfusion: an effective and safe approach to retrograde protection against myocardial
ischemia in patients undergoing normal and high risk percutaneous transluminal coronary angioplasty. J
Am Coll Cardiol 1998;31(7):1525-33.
13.
Boekstegers P, von Degenfeld G, Giehrl W, Heinrich D, Hullin R, Kupatt C, Steinbeck G, Baretton
G, Middeler G, Katus H, Franz WM. Myocardial gene transfer by selective pressure-regulated retroinfusion
of coronary veins. Gene Ther 2000;7(3):232-40.
14.
Boekstegers P, von Degenfeld G, Giehrl W, Kupatt C, Franz W, Steinbeck G. Selective pressureregulated retroinfusion of coronary veins as an alternative access of ischemic myocardium: implications
for myocardial protection, myocardial gene transfer and angiogenesis. Z Kardiol 2000;89 Suppl 9:IX/10912.
15.
Kupatt C, Hinkel R, Vachenauer R, Horstkotte J, Raake P, Sandner T, Kreuzpointner R, Muller F,
Dimmeler S, Feron O, Boekstegers P. VEGF165 transfection decreases postischemic NF-kappa Bdependent myocardial reperfusion injury in vivo: role of eNOS phosphorylation. Faseb J 2003;17(6):705-7.
16.
Gaballa MA, Peppel K, Lefkowitz RJ, Aguirre M, Dolber PC, Pennock GD, Koch WJ, Goldman S.
Enhanced vasorelaxation by overexpression of beta 2-adrenergic receptors in large arteries. J Mol Cell
Cardiol 1998;30(5):1037-45.