Chen et al, hepatocyte-specific Gclc deletion, Supplementary Materials
Targeting construct and targeting procedure for the generation of Gclc floxed mice-The key
features of the targeting construct are shown in supplemental Fig. 1a. Complete details for the
generation of this construct may be obtained by emailing tim.dalton@uc.edu. Briefly summarized, a
neomycin resistance gene (neoR) flanked by loxP sites was cloned into the Sac I site in intron 3 of
the Gclc gene, and an additional loxP site was cloned into the Bgl II site in intron 6, which is
proximal to the exon 6 splice-donor site. The construct also contained the herpes simplex virus
thymidine kinase (HSV-TK) mini-cassette for negative selection against random integration. The
targeting construct was electroporated into embryonic stem (ES) cells derived from 129S6/SvJ mice.
ES clones, resistant to both geneticin (G418) and gancyclovir, were selected and expanded. Targeted
ES cells were identified by Southern blot analysis (see below). The correctly targeted ES cell clones
were microinjected into C57BL/6J blastocysts and transferred into pseudo-pregnant mothers. The
resulting chimeric male mice were bred to female C57BL/6J mice, and germ line transmission was
identified by both Southern blot and PCR analysis. For abbreviations, the three different Gclc alleles
(sup Fig.1a) are denoted as: “+” for the wild-type allele; “f” for the floxed conditional Gclc allele;
and “h” for the hepatocyte-specific Gclc deleted allele after Cre-mediated recombination.
Southern blot and PCR analysis-For differentiation of the Gclc(f) versus Gclc(+) allele, genomic
DNA isolated from ES cells or mouse tissues was digested overnight with Sph I and processed for
Southern blot analysis using the Sph I-Bam HI probe, depicted in supplementary Fig. 1a. For
differentiation of the Gclc(f) versus Gclc(h) allele, genomic DNA was digested with Sac I, blotted,
and hybridized with a probe encompassing 200 bp 5’ of the intron 6 Sac 1 site, as depicted in
supplementary Fig. 1a. The band intensity was quantified using a Storm 860 Phosphorimager
(Molecular Dynamics; Sunnyvale, CA) and ImageQuant 5.0 software. Genotyping was also
confirmed by PCR analysis. The Gclc(f) allele was detected using primers A
1
Chen et al, hepatocyte-specific Gclc deletion, Supplementary Materials
(GGGTGTTGGGTCGTTTGT) within the NEO gene, and B (CTATAATGTCCTGCACTGGG)
within intron 3. The Gclc(h) allele was detected using primers C (TAGTGAACGGTGTTAAAGG)
within intron 3, and D (TCACTGGATTCTCTCACC) within intron 6. The Gclc(+) allele was
detected using primers B and C. Primers (GCGGTCTGGCAGTAAAAACTATC) and
(GTGAAACAGCATTGCTGTCACTT) were used to detect the Cre transgene.
Characterization of Gclc(f/f) mice-Gclc(f/+) mice were intercrossed to generate homozygous
Gclc(f/f) mice, and the offspring were genotyped by Southern blot (sup Fig. 1b) and PCR analysis.
The birth of mice of each possible genotype [Gclc(+/+), Gclc(+/f), Gclc(f/f)] was at expected
Mendelian frequencies (data not shown). Gclc(f/f) are without phenotype and did not differ
noticeably from wild-type Gclc(+/+) mice. This is because the Gclc(f) allele, despite carrying
foreign sequences in introns 3 and 6, is expressed like the Gclc(+) allele. For example, in liver, no
significant difference in the accumulation of GCLC or GSH was noted (sup Figs. 1c and 1d).
Furthermore, GSH levels from several tissues and plasma did not differ between Gclc(+/+) and
Gclc(f/f) mice (sup Fig. 1d). Previous studies using haploinsufficient Gclc(+/-) mice lowered GSH
levels, demonstrating that GSH levels are sensitive to changes in Gclc copy number. Comparisons
between Gclc(+/+) and Gclc(f/f) mice––including several tissues assayed between age 0 and 6 mo
showed no difference in GCLC protein accumulation (sup Fig. 1c, showing liver only), activity (not
shown), or GSH levels (sup Fig. 1d). Taken together, we conclude that the Gclc(f) allele is
functionally indistinguishable from the Gclc(+) wild-type allele.
2
Chen et al, hepatocyte-specific Gclc deletion, Supplementary Materials
Supplemental Fig. 1. Generation of Gclc floxed mice. (a) Schematic of the wild-type Gclc allele
(+), targeting-construct targeted allele (f), and the deleted allele (h), following Cre-mediated
recombination. NEO, neomycin-resistance mini-cassette, and HSV-TK, herpes simplex virus
thymidine kinase mini-cassette, represent genes used as selectable markers. The positions of primers
for PCR analysis are shown as arrows. (b) Southern blot analysis. Genomic DNA from mouse
spleen was digested with Sph I and hybridized with the probe A shown in (a). The 7.5-kb and 3.0-kb
bands represent the Gclc(+) and Gclc(f) alleles, respectively. (c) Western blot analysis of GCLC in
livers from Gclc(+/+), Gclc(+/f), and Gclc(f/f) mice. (d) Tissue and plasma GSH levels in
Gclc(+/+) wild-type and Gclc(f/f) floxed mice. Measurements reflect the means ± S.E. of samples
from 3 or 4 mice.
3
Chen et al, hepatocyte-specific Gclc deletion, Supplementary Materials
Tissue preparation for histopathological examination-For hematoxylin and eosin (H&E) staining
and immunohistochemical studies, mouse livers were fixed in 4% paraformaldehyde, dehydrated in
graded ethanol solutions, and embedded in paraffin. Sections (5 m thick) were rendered free of
paraffin by immersing in xylene, rehydrated and stained with H&E or subjected to
immunohistochemistry.
For toluidine blue staining and electron microscopy, mouse livers were fixed in an iso-osmolar
paraformaldehyde/glutaldehyde-phosphate-buffered solution, post-fixed in 1% phosphate-buffered
osmium tetroxide, dehydrated in graded ethanol solutions ranging from 30-100%, treated with
propylene oxide, and embedded in Spurr’s resin. Sections (1 m thick) were stained with toluidine
blue for light microscopy. Thin sections for electron microscopy were placed on naked copper grids
and stained with uranyl acetate and lead citrate.
4