An evolutionary shift in the regulation of the Hippo
pathway between mice and flies
Wouter Bossuyt, Chiao-Lin Chen, Qian Chen, Marius Sudol, Helen McNeill, Duojia
Pan, Artyom Kopp, and Georg Halder
Supplemental information
1. Supplemental Figure Legends
Supplemental Figure 1: Conservation, protein domains and protein-protein
interactions in Hippo pathway core components.
A) The phylogenetic distribution of the different core components and Merlin and
Kibra of the Hippo pathway. Green indicates that an ortholog is present and red
marks it’s absence. B) Schematic representation of the domain composition of
different Hippo pathway components. Horizontal black lines under the proteins
indicate domains that are essential for binding to other members of the Hippo
pathway. Black ticks in proteins indicate phosphorylation sites. Human and fruitfly
proteins are marked by a human and fly character respectively. The EBI domain
nomenclature was used.
Supplemental Figure 2: Protein domains and protein-protein interactions in Hippo
pathway inputs.
Schematic representation of the domain composition of different Hippo pathway
inputs. The domain that is essential for binding to other members of Hippo signaling
are indicated by horizontal black lines below the proteins. Black ticks in proteins
indicate phosphorylation sites. Human and fruitfly proteins are marked by a human
and fly character respectively. The EBI domain nomenclature was used. The red box
in Drosophila Fat indicates the arthropod-specific motif that is necessary for the
interaction with Hippo signaling.
Supplemental Figure 3: Multiple sequence alignment of the intracellular domain of
Fat proteins form different animals.
We used orthologs of different species, namely for arthropods Drosophila
melanogaster (fruitfly), Anopheles gambiae (mosquito), Tribolium castaneum
1
(beetle), and Daphnia pulex (crustacean); for the species outside of arthropods:
Homo sapiens (human), Mus musculus (mouse), Branchiostoma floridae (lancelet),
and Lottia gigantean (mollusk). Conserved residues are marked by dark background.
The transmembrane domain is indicated by a black box. The different deletions used
in the UAS-Ft constructs are marked and numbered by red boxes. The residue that is
mutated in the ftsum mutant, in which isoleucine 4852 is substituted for asparagine, is
highlighted in a blue box. Drosophila Ft deletion constructs span the following
residues: FtΔ1: aa 4704-4713, FtΔ2: aa 4744-4770, FtΔ3: aa 4834-4899, FtΔ4: aa 49224955, FtΔ5: aa 4973-4994, FtΔ6: aa 5044-5074, FtΔ7: aa 5089-5114, and FtΔ8: aa
5144-5147. Region 3 is highly conserved in arthropods but is not conserved outside
of arthropods. The Hippo pathway interacting domains that were discovered by
Matakatsu and Blair are indicated with solid black lines above the alignment marked
Hippo N and Hippo C.
Supplemental Figure 4:The effect of Ft deletions constructs on wing size.
We tested the tumor suppressor function of the different Ft constructs by analyzing
the ability to reduce wing size in ft mutant animals. All Ft overexpression constructs
except FtΔ3 reduces the wing size of Ft mutants. Genotypes are indicated below each
panel. Only female wings were used.
Supplemental Figure 5: The effects of Ft deletion constructs on ex-lacZ and
compartment size in the wing imaginal disc.
All Ft overexpression constructs except FtΔ3 reduces ex-lacZ expression in the
posterior compartment and the compartment size when overexpressed by hh-Gal4 in
a ft-mutant background. Genotypes are indicated below each panel. (J)
Quantifications of size of the posterior compartment of third instar wing imaginal
discs upon expression of Ft overexpression constructs normalized to the entire wing
disc size. (K) Quantifications of ex-lacZ expression in the posterior compartment of
third instar wing imaginal discs upon expression of Ft overexpression constructs
normalized to ex-lacZ expression in the anterior part. Double asterisk indicate p<0,01
and single asterisk indicate p<0,05 as tested by one-way ANOVA.
Supplemental Figure 6: The effects of Ft deletion constructs on planar cell polarity
of the abdominal hairs in pharate adults.
All Ft overexpression constructs except FtΔ3 reduces the planar cell polarity
phenotype of abdominal hairs of Ft mutants. Genotypes are indicated below each
panel.
2
Supplemental Figure 7: Polydot plot showing the conservation of Expanded within
arthropods and the lower conservation outside of arthropods. All Expanded
homologs are aligned to each other and a stretch of 4 similar residues is represented
by a dot. All Ex homologs show alignment with the FERM domain of Expanded of
Drosophila melanogaster, marked by a red box. Within arthropods, Expanded is
highly conserved.
2. Fly Genotypes
Figure 2
2A,C: +/ ftsum
2B,D: ftsum / ftsum
2E: y w, hs-Flp; FRT40A ubi-GFP/FRT40A ft422; diap1-lacZ / +
2F: y w, hs-Flp; FRT40A ubi-GFP/FRT40A ftsum; diap1-lacZ / +
2G: w
2H: w; ft422/ ftfd
2I: w; ft422/ ftfd; tub-Gal4, UAS-Ft FL
2J: ftsum / ftsum
2K: y w, hs-Flp; FRT40A ubi-GFP/FRT40A ft422
-lacZ / +
2L: y w, hs-Flp; FRT40A ubi-GFP/FRT40A ftsum
-lacZ / +
Figure 3
3B: y w
3C: w; ft422/ ftG-rv
3D: w; ft422/ ftG-rv; act-Gal4/ UAS-Ft FL
3E: w; ft422/ ftG-rv; act-Gal4/ UAS-Ft Δ3
3H: w; ft422/ ftfd, ex697; hh-Gal4/ UAS-Ft FL
3I: w; ft422/ ftfd, ex697; hh-Gal4/ UAS-Ft ΔECD
3
3J: w; ft422/ ftfd, ex697; hh-Gal4/ UAS-Ft Δ3
3K: yw, hs-Flp; fj-lacZ, FRT40A, Ft422/FRT40A, ubi-GFP; DE-Gal4/UAS-Ft3only
Figure S4
S4A: w
S4B: w; ft422/ ftG-rv
S4C: w; ft422/ ftG-rv; act-Gal4/ UAS-Ft FL
S4D: w; ft422/ ftG-rv; act-Gal4/ UAS-Ft ΔECD
S4E: w; ft422/ ftG-rv; act-Gal4/ UAS-Ft Δ1
S4F: w; ft422/ ftG-rv; act-Gal4/ UAS-Ft Δ2
S4G: w; ft422/ ftG-rv; act-Gal4/ UAS-Ft Δ3
S4H: w; ft422/ ftG-rv; act-Gal4/ UAS-Ft Δ4
S4I: w; ft422/ ftG-rv; act-Gal4/ UAS-Ft Δ5
S4J: w; ft422/ ftG-rv; act-Gal4/ UAS-Ft Δ6
S4K: w; ft422/ ftG-rv; act-Gal4/ UAS-Ft Δ7
S4L: w; ft422/ ftG-rv; act-Gal4/ UAS-Ft Δ8
Figure S5
S5A: w; ft422/ ex697, ftfd, FRT40a ; act-Gal4 / UAS-Ft ΔECD
S5B: w; ft422/ ex697, ftfd, FRT40a; act-Gal4 / UAS-Ft Δ1
S5C: w; ft422/ ex697, ftfd, FRT40a; act-Gal4 / UAS-Ft Δ2
S5D: w; ft422/ ex697, ftfd, FRT40a; act-Gal4 / UAS-Ft Δ3
S5E: w; ft422/ ex697, ftfd, FRT40a; act-Gal4 / UAS-Ft Δ4
S5F: w; ft422/ ex697, ftfd, FRT40a; act-Gal4 / UAS-Ft Δ5
S5G: w; ft422/ ex697, ftfd, FRT40a; act-Gal4 / UAS-Ft Δ6
S5H: w; ft422/ ex697, ftfd, FRT40a; act-Gal4 / UAS-Ft Δ7
S5I: w; ft422/ ex697, ftfd, FRT40a; act-Gal4 / UAS-Ft Δ8
Figure S6
4
S6A: w
S6B: w; ft422/ ftG-rv
S6C: w; ft422/ ftG-rv; act-Gal4/ UAS-Ft FL
S6D: w; ft422/ ftG-rv; act-Gal4/ UAS-Ft Δ1
S6E: w; ft422/ ftG-rv; act-Gal4/ UAS-Ft Δ2
S6F: w; ft422/ ftG-rv; act-Gal4/ UAS-Ft Δ3
S6G: w; ft422/ ftG-rv; act-Gal4/ UAS-Ft Δ4
S6H: w; ft422/ ftG-rv; act-Gal4/ UAS-Ft Δ5
S6I: w; ft422/ ftG-rv; act-Gal4/ UAS-Ft Δ6
S6J: w; ft422/ ftG-rv; act-Gal4/ UAS-Ft Δ7
S6K: w; ft422/ ftG-rv; act-Gal4/ UAS-Ft Δ8
3. Supplemental Methods
Tracing the evolutionary history of genes and protein domains
To test for the presence or absence of each gene or protein domain in each of the
candidate taxa, we first conducted BLAST/tblastn searches using human and one or
more insect protein sequences as queries under default tblastn parameters.
Analysis was restricted to species with fully sequenced genomes. Initial searches
were performed against species-specific protein or predicted gene databases. In
cases where a gene appeared to be absent from one or more taxa, we used three
strategies to either identify this gene or confirm its absence. First, we conducted
tblastn searches against the latest (as of June 2011) assembly of the genome
sequence, thus eliminating potential false negatives that might result from errors in
gene prediction. Second, we repeated tblastn searches using query sequences from
several of the closest available relatives of the taxon in question. For example, Amot
sequences from Mayetiola, Lutzomyia, and Anopheles were used to search the
genomes of Drosophila, Ceratitis, and Glossina; the C-terminal domains of Ex from
Daphnia, Nasonia, and Bombyx were used to search the genome of Ixodes, etc. (see
Figure 2 for phylogenetic relationships). Third, the E-value cutoff was raised to 10,
and any sequences identified under these parameters were subjected to
phylogenetic analysis (see below).
5
In cases where the presence of a particular protein domain, rather than the entire
gene, was in question in one or more taxa, we used two strategies to either identify
this domain or confirm its absence. First, we conducted tblastn searches against
species-specific protein or predicted gene databases using full-length genes from
several other taxa as queries, and examined the gene models identified by these
searches. Second, we performed tblastn searches against the latest assembly of the
genome sequence using isolated sequences of the domain in question from several
taxa as queries. If no significant hits were found using this approach, we concluded
that this domain was absent or has diverged to the point where homology is
impossible to establish.
In cases where homology was uncertain, or where there were multiple paralogs in
some or all genomes (e. g. for Dachs), we used phylogenetic analysis to confirm or
reject the orthology of genes from different taxa. Protein sequences were aligned
and gene trees reconstructed from multiple sequence alignments using the PhyML
algorithm (http://www.phylogeny.fr/).
Genes from different taxa were considered
orthologous if they formed a monophyletic clade that did not include related
sequences from the same taxa.
Databases used
The following taxa and sequence databases were searched (see Figure 2 for
phylogenetic relationships):
Diptera
Drosophila melanogaster, Anopheles gambiae, Aedes aegypti, and Culex pipiens
using the Flybase BLAST tool (http://flybase.org/blast/); Lutzomyia longipalpis and
Mayetiola destructor using the Baylor College of Medicine Human Genome
Sequencing Center (HGSC) genome databases and BLAST search tools
(http://blast.hgsc.bcm.tmc.edu/blast.hgsc); Glossina morsitans using the Wellcome
Trust
Sanger
Institute
database
and
BLAST
tool
(http://www.sanger.ac.uk/Projects/G_morsitans/); For Ceratitis capitata, a draft
genome assembly was kindly made available by Dr. Alfred Handler and colleagues,
and searched using stand-alone BLAST.
Hymenoptera
Nasonia vitripennis and Apis melifera using the Flybase BLAST tool; Harpegnathos
6
saltator, Camponotus floridanus, Acromyrmex echinatior, and Solenopsis invicta
using the NCBI databases and BLAST tools (http://blast.ncbi.nlm.nih.gov/Blast). Due
to the preliminary state of genome assemblies in some hymenopterans, a gene was
considered to have been present in the last common ancestor of Hymenoptera if it
was identified in at least one hymenopteran species as well as in non-hymenopteran
insects.
Other insects
Bombyx mori (Lepidoptera), Tribolium castaneum (Coleoptera), Acyrthosiphon pisum
(Hemiptera), and Pediculus humanus (Phthiraptera) using the Flybase BLAST tool.
Non-insect arthropods
Daphnia pulex (Cladocera, Branchiopoda, Crustacea) using the NCBI and
wFleaBase (http://wfleabase.org/database/) databases and BLAST tools. Ixodes
scapularis (Acari, Arachnidae, Chelicerata) using the Vectorbase databases and
BLAST tools (http://iscapularis.vectorbase.org/).
Nematodes
Caenorhabditis elegans, Brugia malayi, Loa loa, and Ascaris suum using the NCBI
databases and BLAST tools
Lophotrochozoan phyla
Capitella teleta and Helobdella robusta (Annelida) and Lottia gigantea (Mollusca)
using
the
Joint
Genome
Institute
(JGI)
databases
and
BLAST
tools
(http://genome.jgi-psf.org/). Due to the preliminary state of genome assemblies in
these taxa, a gene was considered to have been present in the last common
ancestor of Lophotrochozoa if it was identified in at least one lophotrochozoan
species as well as in ecdysozoans and/or deuterostomes.
Vertebrates
Multiple
mammalian
species,
Gallus
gallus
(Aves),
Xenopus
tropicalis
(Amphibia),and Danio rerio (Actinopterygii) using the NCBI databases and BLAST
tools.
Non-vertebrate chordates
Branchiostoma floridae (Cephalochordata) and Ciona intestinalis (Urochordata) using
the NCBI databases and BLAST tools.
7
Ambulacraria
Strongylocentrotus purpuratus (Echinodermata) and Saccoglossus kowalevskii
(Hemichordata) using the NCBI databases and BLAST tools.
Cnidaria
Nematostella vectensis using the JGI database and BLAST, and Hydra
magnipapillata using the Metazome website (http://hydrazome.metazome.net/cgibin/gbrowse/hydra/).
Primers used
ft-DECD-Not-RI-N5';
AAATAATAGCGGCCGCGAATTCAAACCATGGAGAGGCTACTGCTC
ft-DECD-Kpn-C3': ATAATAGGTACCTTACACGTACTCCTCTGGAGC
ft-DECD-D1-C5': GCAGCAACGTCCCCAGCTGATAAGGGAGGATCATCAC
ft-DECD-D1-N3': GATCCTCCCTTATCAGCTGGGGACGTTGCTGCTGCTG
ft-DECD-D2-C5': CATGGGTTCCGAGTACGAGGCTGCTGGCCTACGCAAA
ft-DECD-D2-N3': GTAGGCCAGCAGCCTCGTACTCGGAACCCATGTCCAC
ft-DECD-D3-C5': CCGCACCCATCAGAGCCAAAGTTCCAGTGCCAGCAGG
ft-DECD-D3-N3': TGGCACTGGAACTTTGGCTCTGATGGGTGCGGGATGC
ft-DECD-D4-C5': GCAGCAAACTTCCATGGTGTCGAGCAGCGCTCTGCAT
ft-DECD-D4-N3': GAGCGCTGCTCGACACCATGGAAGTTTGCTGCGCCTG
ft-DECD-D5-C5': AGATGTGGATGCCCATAACAGTCTCAGTGGCGACGGC
ft-DECD-D5-N3': CGCCACTGAGACTGTTATGGGCATCCACATCTCCACC
ft-DECD-D6-C5': CATTCCGCCGCACGCCAAGGCCAATGGAGCCGCATCC
ft-DECD-D6-N3': CGGCTCCATTGGCCTTGGCGTGCGGCGGAATGGGCGG
ft-DECD-D7-C5': GGCCACCACCCTCGGCACAAATGGACCGTCGCAGCAA
ft-DECD-D7-N3': GCGACGGTCCATTTGTGCCGAGGGTGGTGGCCGATGG
ft-DECD-D8-N3': ATAATAGGTACCTTATGGAGCCGCCGGTCCATTCGA
8