BLAST LAB Use NCBI BLAST tools to analyze the following DNA that you just sequenced from a plasmid and answer the following questions: GGGCGAATTGGGCCCGACGTCGCATGCTCCCGGCCGCCATGGCCGCGGGATA CGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTCGCTCCCCAACGCTT TCGCTCCTCAGCGTCAGTTACTGCCCAGAGACCCGCCTTCGCCACCGGTGTTC CTCCTGATATCTGCGCATTCCACCGCTACACCAGGAATTCCAGTCTCCCCTGC 1. Use VecScreen (http://www.ncbi.nlm.nih.gov/VecScreen/VecScreen.html) to identify if there is vector contamination. If there is contamination, what is it? 2. Trim out any offending contamination and do a Nucleotide-nucleotide BLAST (blastn) (http://www.ncbi.nlm.nih.gov/BLAST/) search with the good stuff. (a) The highest scoring BLAST hit is to what organism? (b) What is the gene? (c) Who submitted the sequence and from what institution? (d) Get the following data for the “hit” - E-value: Identities: FOR YOUR PROJECT Do a short write up (1-2 pages) with the following outline... Title Materials and Methods - include everything that you needed to complete project - PCR, DNA isolation, bioinformatics, etc Results - make a table of results Sequence Identification Appendix - sequences Name of closest hit % identity