1
Supplementary Methods
Zebrafish strains. Wild type (AB), mlc2a-eGFP (ref. 1), nlsi26 (ref. 2), and oeptz257 (ref.
3) zebrafish strains were used in this study. Zebrafish embryos were maintained at
28.5°C by standard methods4.
Pharmacological treatments. Omeprazole (Sigma) and SCH 28080 (Sigma) were
added at a final concentration of 25M and 100 M, respectively, to zebrafish embryos
in embryo medium from 100 mM stocks in DMSO. Omeprazole treatment was
performed in two developmental windows: a) embryos were incubated with omeprazole
from the 1-2-cell stage until bud stage, then extensively washed with embryo medium
and kept in embryo medium until the desired stage, and b) omeprazole was added to
50%-75% epiboly embryos and the incubation proceeded until the desired stage. DAPT
(-secretase inhibitor IX, Calbiochem) was added to 75% epiboly-bud stage zebrafish
embryos at a final concentration of 100 M from a 50 mM stock in DMSO. The
incubation with DAPT proceeded until the 3-somite stage, when it was replaced with
fresh embryo medium and the embryos were then allowed to reach the desired stage. In
some experiments, SCH 28080 or DAPT was added at the concentrations indicated
above to 1-, 32-, or high-cell, 50% or 75% epiboly, or 1-somite stages mlc2a-eGFP
zebrafish embryos, and extensively washed out with embryo medium at 32- or 1k-cell,
50% or 75% epiboly, 1- or 10-somite stage, respectively. The embryos were left to
develop until 48 hpf and scored for heart looping. SU5402 (Calbiochem) was added to
manually dechorionated embryos at the bud stage, at a final concentration of 40 M
from a 3.4 mM stock in DMSO. The embryos were incubated with SU5402 until they
reached the desired stage. Control zebrafish embryos for each experimental condition
were incubated in equivalent concentrations of DMSO.
Morpholino and mRNA injections. Capped mRNA encoding Axin or GFP were
synthesized in vitro using the mMessage mMachine kit (Ambion) following the
2
manufacturer’s directions. We injected 120 pg/embryo of either mRNA in the yolk of 1cell stage zebrafish embryos. A morpholino targeted against the putative translational
start site of raldh2 (5’-gttcaacttcactggaggtcatc, described in ref. 2) was obtained from
GeneTools, LLC. We injected 1-cell stage zebrafish embryos with 2 pmole/embryo of
raldh2-MO. A morpholino targeted against the putative translational start site of fgf8
(5’-gagtctcatgtttatagcctcagta, described in ref. 5) was obtained from GeneTools, LLC.
We injected 1-cell stage zebrafish embryos with 1 pmole/embryo of fgf8-MO. A
morpholino targeted against the putative translational start site of lrd (5’cggttcctgctcctccatcgcgccg) was designed by GeneTools, LLC. The reported sequence of
zebrafish lrdr1 (ref. 6) was mapped to Enzemble scaffold Zv4_NA11091. By walking
the scaffold sequence, we found a possible exon containing the translation start site,
and, based on the sequence analysis, we cloned a cDNA covering the putative 1st and
2nd exons by RT-PCR. The clone showed essentially the same expression pattern as the
reported lrdr1 probe clone by in situ hybridization between 90% epibody and 8-somite
stages. Sequence analysis indicated that the sequence of the clone has homology to rat
beta heavy chain of outer-arm axonemal dynein. This sequence was identified as lrdr1
in the latest annotated Ensemble database. We injected 1- or 1k-cell stage embryos with
0.2 pmole/embryo of lrd-MO. For each control experiment, equivalent amounts of the
standard control morpholino (available from GeneTools, LLC) were used.
In situ hybridization. Whole-mount in situ hybridization of zebrafish embryos was
performed essentially as described7. The reported sequences of raldh2, cyp26a1,
cyp26b1, rar2a, rar2b, rar, rxr, rxr, rxr, and rxr were used to amplify specific
sequences for in situ hybridization probes. A partial sequence of a putative cyp26c1 was
cloned by RT-PCR. The sequence showed homology to both cyp26b1 and cyp26c1 in
other species, but is distinct from the reported zebrafish cyp26b1. Based on the similar
expression pattern compared to cyp26c1 in chick, we refer to this clone here as
zebrafish cyp26c1. The sequences of zebrafish uncx4 and cyp26c1 cDNAs have been
3
deposited in GenBank with accession numbers AY881012 and AY904031, respectively.
Details of the specific probes are available upon request.
Immunofluorescence. Embryos were dechorionated and fixed in 3.7%
formaldehyde/PBS for 1 hour at room temperature, followed by washing with PBT, and
blocking in 5% donkey serum, 2% BSA in PBT. H+/K+-ATPase  immunoreactivity
was analyzed with polyclonal antibodies against a porcine H+/K+-ATPase  subunit that
recognize the stingray protein (ref. 8, a kind gift of A. Smolka) and with a commercial
monoclonal antibody against porcine H+/K+-ATPase  (US Biochemical). Primary
antibodies were used at a dilution of 1:100 in blocking buffer at room temperature for 1
hour. After washing with PBT containing 2% BSA, the embryos were incubated with
either FITC-anti mouse IgG (1: 200) or FITC-anti rabbit IgG (1:400) (Jackson
ImmunoResearch Laboratories, Inc.), washed with PBT, and photographed. For
visualizing cilia, embryos were fixed and blocked similarly, and then incubated with
anti-acetylated-tubulin antibody (Sigma) at a dilution of 1: 200, washed with PBT
containing 2% BSA, and then, incubated with Cy3-anti-mouse IgG. After washing,
Kupffer’s vesicle was visualized and photographed with a Zeiss M2Bio fluorescence
stereomicroscope.
Visualization of fluid flow in Kupffer’s vesicle. 6-somite stage zebrafish embryos
were manually dechorionated and mounted in 3% methylcellulose in embryo media so
that Kupffer’s vesicle was readily visible and facing upwards. Fluorescent latex beads
with an average size of 1 m (Sigma) were injected into Kupffer’s vesicle. The beads
were visualized and photographed over time on a Zeiss M2Bio fluorescence
stereomicroscope using OpenLab software.
4
References
1.
Raya, A. et al. Activation of Notch signaling pathway precedes heart regeneration
in zebrafish. Proc Natl Acad Sci U S A 100, 11889-95 (2003).
2.
Begemann, G., Schilling, T. F., Rauch, G. J., Geisler, R. & Ingham, P. W. The
zebrafish neckless mutation reveals a requirement for raldh2 in mesodermal signals
that pattern the hindbrain. Development 128, 3081-94 (2001).
3.
Haffter, P. et al. The identification of genes with unique and essential functions in
the development of the zebrafish, Danio rerio. Development 123, 1-36. (1996).
4.
Westerfield, M. The zebrafish book. A guide for the laboratory use of zebrafish
(Danio rerio). (Univ. of Oregon Press, Eugene, 2000).
5.
Maroon, H. et al. Fgf3 and Fgf8 are required together for formation of the otic
placode and vesicle. Development 129, 2099-108 (2002).
6.
Essner, J. J. et al. Conserved function for embryonic nodal cilia. Nature 418, 37-8.
(2002).
7.
Hammerschmidt, M. et al. dino and mercedes, two genes regulating dorsal
development in the zebrafish embryo. Development 123, 95-102 (1996).
8.
Smolka, A. & Swiger, K. M. Site-directed antibodies as topographical probes of the
gastric H,K-ATPase alpha-subunit. Biochim Biophys Acta 1108, 75-85 (1992).