Supplementary information
Materials and Methods
The Animals and Culture Conditions. The wild-type C. elegans strains N2 (Bristol),
and MQD397 hqIs92 [pDYH59(Punc-119::unc-119+Ppud-2.2::GFP::pud-2.2)] II (a
gift from Dr. Mengqiu Dong, NIBS) were maintained under standard culture
conditions and methods1, 2. Worms are normally cultured at 20°C and all experiments
were performed at 20°C, or otherwise specified. Strains used in our study are listed in
Table S1d.
The Tübingen wild type zebrafish eggs were acquired from paired mating and
raised at 28.5℃ in petri dishes containing embryo medium, according to Westerfield3.
All zebrafish experiments were approved by the Institutional Animal Care and Use
Committee (IACUC) of Peking University and reference from IACUC of Peking
University is LSC-LiuD-01. Embryos were staged by hours post fertilization (hpf) or
by standard morphological criteria4.
Molecular Cloning dCas9: Plasmid 461685 (Addgene: 46168) was used as the
template for mutagenesis to get the dCas9 ORF without stop codon. Transgene fast
mutagenesis system (Kit: FM111) was used to mutagenize D10A and H840A. The
dCas9 DNA fragment was then cloned into AgeI and NheI restricted L4440 vector.
The C. elegans codon optimized KRAB domain and 10 copies of minimal VP16
activation domain (VP160) were synthesized and ligated into dCas9/L4440 to
generate dCas9-KRAB and dCas9-VP160 constructs using the NheI restriction site,
respectively. The SV40-NLS and egl-13 NLS sequences were ligated to both (5’ and
3′) ends of dCas9-KRAB or dCas9-VP160 to generate NLSSV40-dCas9 (dCas9-KRAB
or dCas9-VP160)-NLSegl-13 cassettes. The resulted cassettes were cloned into
pPD95_75 at the XmaI and EcoRI sites. Specific promoters (Pges-1, Pdpy-5,
Phsp-16.2 and Pdbl-1) were PCR amplified from N2 genomic DNA, and placed
upstream of the dCas9 cassette. For zebrafish experiment, the human dCas9 with
SV40-NLS sequence was fused with KRAB and VP160 domain respectively, and then
cloned into EcoR1 and Spe1 restricted pXT7 vector. (Fig. 1B, C)
ts-gRNA: The known sequence requirements for dCas9/ts-gRNA are: (i) a
protospacer adjacent motif (PAM) sequence, NGG, must be adjacent to the 3’ end of
the target sequence; and (ii) the first nucleotide at 5’end of the target sequence has to
be G, to allow efficient ts-gRNA transcription mediated by the U6 promoter in vivo or
T7 promoter in vitro. A consensus sequence, G-(N19)-NGG, is strictly set for each
ts-gRNA encoding cassette. We aimed to target either the coding sequence to block
transcriptional elongation or proximal promoter sequence for transcriptional
activation. We used the UCSC genome browser to search for a string of sequences
that met the above criteria for each gene of interest6, 7. The target sequences were
made by annealing two gene specific oligonucleotides (complementary to each other)
with two BbsI restriction sites. 50μM of each oligonucleotide was mixed and heated
at 95℃ for 5 min, incubated at 37℃ for 10 min, and the annealed products were ready
for use. The BbsI restricted vector and annealed oligonucleotides were ligated and all
cloned inserts were verified by sequencing.
Microinjection and Transgenic Lines of Worms Gonad microinjection was
performed according to standard C. elegans procedures in young adult
hermaphrodites8. To generate tissue-specific dCas9 or dCas9-effector transgenic lines,
20 ng/μl Ptissue-specific:: dCas9 (or dCas9-effector, final concentration), 20 ng/μl
ts-gRNA (the concentration of ts-gRNA plasmid DNAs is equivalent between the
single and multiple ts-gRNA experiments) and 20 ng/μl Pcol-10::mCherry (a
co-injection transgene marker) were injected into each gonad. At least three
independent lines, stably carrying plasmid DNA as extra chromosomal arrays, were
obtained per construct. The transgenic lines used in our study are listed in Table S1d.
RNAi Experiments The sequences corresponding to the target genes were amplified
from cDNA of N2 worms by PCR. The RNAi constructs were generated by inserting
the PCR products into the L4440 vector and transformed into E.coli HT115 strain for
feeding RNAi experiments. Detail of dpy-5 RNAi experiments was described
previously9. The primers used for RNAi constructs are listed in Table S1f
Heat Shock Treatment Synchronized Worms were collected by allowing
approximately 100 adult animals to lay eggs for 1 h on a NGM plate at first, removing
the adults, and raising the embryos at 20°C before heat treatment. At desired
developmental stage(s) (early L4 stage), the worms were treated on the agar plates
floating in a 35°C water bath for one hour, and recovered at 20°C. After 10 hours, the
GFP intensity was then imaged using the same exposure and analyzed using ImageJ 10.
Measure Body Length and Statistics L4 transgenic hermaphrodites (with mCherry
fluorescence) grown at 20°C were transferred to fresh NGM plates. One day later,
Worms were mounted on 3% agarose pads (in M9 buffer) and paralyzed with a drop
of 100 mM levamisole and examined and photographed under 10 or 20 objectives
with Zeiss axioplan compound microscope. Only transgenic young adult animals
(with mature oocytes and few embryos (<<2)) were used for body length
measurement by free Java image processing program ImageJ11. Body lengths are
mean ± SEM (standard error of the mean). p values were calculated using unpaired
Student's t-test. * indicates p<0.05 while ** indicates p<0.01.
RNA Isolation and Real-time Quantitative RT-PCR Synchronized wild-type and
transgenic worms were kept at 20°C. Total RNA was extracted from freshly frozen
worm pellets using Trizol (Invitrogen) reagent. For zebrafish experiments, 30
embryos at 11hpf were collected and total RNA was extracted by Trizol (Invitrogen).
Extract was digested with RNase-free DNase I for 30 minutes at room temperature,
and cleaned with RNeasy QIAGEN columns. The SuperScriptII reverse-transcriptase
(Invitrogen) and random hexamers were used for reverse transcription of 2.5μg of
RNA/per sample. Real-time PCR was performed using SyBR Green PCR Master Mix
(Applied Biosystems) on a 7900Real Time PCR system (Applied Biosystems). Using
act-1(worm) or beta-actin (zebrafish) as internal controls, relative fold change for
transcripts was calculated using comparative CT (2–ΔΔCT) method. Initial data analysis
was carried out using the Applied Biosystems real-time PCR software. The real-time
PCR experiments were repeated three to four times using independent RNA
preparations. Relative values were expressed as mean ± SEM (standard error of the
mean). p values were calculated using unpaired Student's t-test. * indicates p<0.05; **
p<0.01; and *** p<0.001.
Morpholinos and RNA Injection in Zebrafish All Morpholino oligos were purchased
from Gene Tools Inc. foxi1 MO (2.5mM) or fgf8a MO (5mM) was injected into 1-cell
stage eggs.
foxi1 MO sequence: 5'-TAATCCGCTCTCCCTCCAGAAACAT-3' 12
fgf8a MO sequence: 5’-GAGTCTCATGTTTATAGCCTCAGTA-3’ 13
The pXT7-dCas9-KRAB, -dCas9-VP160 cassettes were linearized by BamH1
restriction enzymes to serve as templates to synthesize stable RNAs. RNA of
dCas9-effector (500ng/μl) and ts-gRNAs (100ng/μl) was injected into 1-cell stage
zebrafish embryos. For mis-expression experiments, the mRNA of foxi1 (30ng/μl) or
fgf8a (30ng/μl) was injected.
Primers All primers used in this study are listed in Tables S1e, f.
Probes and In Situ Hybridization in Zebrafish Embryos untreated or injected were
fixed with 4% paraformaldehyde in PBS at 5 somites stage (11.67hpf). Probe
synthesis and in situ hybridization were performed as previously described14. The
following probes were used: fgf8a and foxi115. Photographs were taken using Leica
165 FC microscope.
REFERENCE
1 Ding YH, Du YG, Luo S et al. Characterization of PUD-1 and PUD-2, two proteins up-regulated
in a long-lived daf-2 mutant. PloS one 2013; 8:e67158.
2 Brenner S. The genetics of Caenorhabditis elegans. Genetics 1974; 77:71-94.
3 Westerfield M. The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). 5th
ed., Univ. of Oregon Press, Eugene. 2007.
4 Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF. Stages of embryonic
development of the zebrafish. Dev Dyn 1995; 203:253-310.
5 Friedland AE, Tzur YB, Esvelt KM, Colaiacovo MP, Church GM, Calarco JA. Heritable genome
editing in C. elegans via a CRISPR-Cas9 system. Nature methods 2013; 10:741-743.
6 Cong L, Ran FA, Cox D et al. Multiplex genome engineering using CRISPR/Cas systems.
Science 2013; 339:819-823.
7 Liu P, Long L, Xiong K et al. Heritable/conditional genome editing in C. elegans using a
CRISPR-Cas9 feeding system. Cell research 2014; 24:886-889.
8 Mello CC, Kramer JM, Stinchcomb D, Ambros V. Efficient gene transfer in C.elegans:
extrachromosomal maintenance and integration of transforming sequences. The EMBO journal
1991; 10:3959-3970.
9 Timmons L, Court DL, Fire A. Ingestion of bacterially expressed dsRNAs can produce specific
and potent genetic interference in Caenorhabditis elegans. Gene 2001; 263:103-112.
10 Tursun B, Patel T, Kratsios P, Hobert O. Direct conversion of C. elegans germ cells into
specific neuron types. Science 2011; 331:304-308.
11 Morck C, Pilon M. C. elegans feeding defective mutants have shorter body lengths and
increased autophagy. BMC developmental biology 2006; 6:39.
12 Hans S, Christison J, Liu D, Westerfield M. Fgf-dependent otic induction requires competence
provided by Foxi1 and Dlx3b. BMC Dev Biol 2007; 7:5.
13 Maroon H, Walshe J, Mahmood R, Kiefer P, Dickson C, Mason I. Fgf3 and Fgf8 are required
together for formation of the otic placode and vesicle. Development 2002; 129:2099-2108.
14 Jowett T, Yan YL. Double fluorescent in situ hybridization to zebrafish embryos. Trends Genet
1996; 12:387-389.
15 Yao D, Zhao F, Wu Y et al. Dissecting the differentiation process of the pre-placodal ectoderm
in zebrafish. Dev Dyn 2014.
Full sequence of dCas9 with nuclear localization sites
NLSSV40 -dCas9(D10A+H840A)-NLSegl-13
ATGACTGCTCCAAAGAAGAAGCGTAAGGTACCGGTAGAAAAA GACAAGAAGTACAGCATCGGCCTGGCCA
TCGGCACCAACTCTGTGGGCTGGGCCGTGATCACCGACGAGTACAAGGTGCCCAGCAAGAAATTCAAGGTGCTGGGCA
ACACCGACCGGCACAGCATCAAGAAGAACCTGATCGGAGCCCTGCTGTTCGACAGCGGCGAAACAGCCGAGGCCACCC
GGCTGAAGAGAACCGCCAGAAGAAGATACACCAGACGGAAGAACCGGATCTGCTATCTGCAAGAGATCTTCAGCAACG
AGATGGCCAAGGTGGACGACAGCTTCTTCCACAGACTGGAAGAGTCCTTCCTGGTGGAAGAGGATAAGAAGCACGAGC
GGCACCCCATCTTCGGCAACATCGTGGACGAGGTGGCCTACCACGAGAAGTACCCCACCATCTACCACCTGAGAAAGA
AACTGGTGGACAGCACCGACAAGGCCGACCTGCGGCTGATCTATCTGGCCCTGGCCCACATGATCAAGTTCCGGGGCC
ACTTCCTGATCGAGGGCGACCTGAACCCCGACAACAGCGACGTGGACAAGCTGTTCATCCAGCTGGTGCAGACCTACA
ACCAGCTGTTCGAGGAAAACCCCATCAACGCCAGCGGCGTGGACGCCAAGGCCATCCTGTCTGCCAGACTGAGCAAGA
GCAGACGGCTGGAAAATCTGATCGCCCAGCTGCCCGGCGAGAAGAAGAATGGCCTGTTCGGAAACCTGATTGCCCTGA
GCCTGGGCCTGACCCCCAACTTCAAGAGCAACTTCGACCTGGCCGAGGATGCCAAACTGCAGCTGAGCAAGGACACCT
ACGACGACGACCTGGACAACCTGCTGGCCCAGATCGGCGACCAGTACGCCGACCTGTTTCTGGCCGCCAAGAACCTGT
CCGACGCCATCCTGCTGAGCGACATCCTGAGAGTGAACACCGAGATCACCAAGGCCCCCCTGAGCGCCTCTATGATCA
AGAGATACGACGAGCACCACCAGGACCTGACCCTGCTGAAAGCTCTCGTGCGGCAGCAGCTGCCTGAGAAGTACAAAG
AGATTTTCTTCGACCAGAGCAAGAACGGCTACGCCGGCTACATTGACGGCGGAGCCAGCCAGGAAGAGTTCTACAAGT
TCATCAAGCCCATCCTGGAAAAGATGGACGGCACCGAGGAACTGCTCGTGAAGCTGAACAGAGAGGACCTGCTGCGGA
AGCAGCGGACCTTCGACAACGGCAGCATCCCCCACCAGATCCACCTGGGAGAGCTGCACGCCATTCTGCGGCGGCAGG
AAGATTTTTACCCATTCCTGAAGGACAACCGGGAAAAGATCGAGAAGATCCTGACCTTCCGCATCCCCTACTACGTGG
GCCCTCTGGCCAGGGGAAACAGCAGATTCGCCTGGATGACCAGAAAGAGCGAGGAAACCATCACCCCCTGGAACTTCG
AGGAAGTGGTGGACAAGGGCGCTTCCGCCCAGAGCTTCATCGAGCGGATGACCAACTTCGATAAGAACCTGCCCAACG
AGAAGGTGCTGCCCAAGCACAGCCTGCTGTACGAGTACTTCACCGTGTATAACGAGCTGACCAAAGTGAAATACGTGA
CCGAGGGAATGAGAAAGCCCGCCTTCCTGAGCGGCGAGCAGAAAAAGGCCATCGTGGACCTGCTGTTCAAGACCAACC
GGAAAGTGACCGTGAAGCAGCTGAAAGAGGACTACTTCAAGAAAATCGAGTGCTTCGACTCCGTGGAAATCTCCGGCG
TGGAAGATCGGTTCAACGCCTCCCTGGGCACATACCACGATCTGCTGAAAATTATCAAGGACAAGGACTTCCTGGACA
ATGAGGAAAACGAGGACATTCTGGAAGATATCGTGCTGACCCTGACACTGTTTGAGGACAGAGAGATGATCGAGGAAC
GGCTGAAAACCTATGCCCACCTGTTCGACGACAAAGTGATGAAGCAGCTGAAGCGGCGGAGATACACCGGCTGGGGCA
GGCTGAGCCGGAAGCTGATCAACGGCATCCGGGACAAGCAGTCCGGCAAGACAATCCTGGATTTCCTGAAGTCCGACG
GCTTCGCCAACAGAAACTTCATGCAGCTGATCCACGACGACAGCCTGACCTTTAAAGAGGACATCCAGAAAGCCCAGG
TGTCCGGCCAGGGCGATAGCCTGCACGAGCACATTGCCAATCTGGCCGGCAGCCCCGCCATTAAGAAGGGCATCCTGC
AGACAGTGAAGGTGGTGGACGAGCTCGTGAAAGTGATGGGCCGGCACAAGCCCGAGAACATCGTGATCGAAATGGCCA
GAGAGAACCAGACCACCCAGAAGGGACAGAAGAACAGCCGCGAGAGAATGAAGCGGATCGAAGAGGGCATCAAAGAGC
TGGGCAGCCAGATCCTGAAAGAACACCCCGTGGAAAACACCCAGCTGCAGAACGAGAAGCTGTACCTGTACTACCTGC
AGAATGGGCGGGATATGTACGTGGACCAGGAACTGGACATCAACCGGCTGTCCGACTACGATGTGGACGCCATCGTGC
CTCAGAGCTTTCTGAAGGACGACTCCATCGACAACAAGGTGCTGACCAGAAGCGACAAGAACCGGGGCAAGAGCGACA
ACGTGCCCTCCGAAGAGGTCGTGAAGAAGATGAAGAACTACTGGCGGCAGCTGCTGAACGCCAAGCTGATTACCCAGA
GAAAGTTCGACAATCTGACCAAGGCCGAGAGAGGCGGCCTGAGCGAACTGGATAAGGCCGGCTTCATCAAGAGACAGC
TGGTGGAAACCCGGCAGATCACAAAGCACGTGGCACAGATCCTGGACTCCCGGATGAACACTAAGTACGACGAGAATG
ACAAGCTGATCCGGGAAGTGAAAGTGATCACCCTGAAGTCCAAGCTGGTGTCCGATTTCCGGAAGGATTTCCAGTTTT
ACAAAGTGCGCGAGATCAACAACTACCACCACGCCCACGACGCCTACCTGAACGCCGTCGTGGGAACCGCCCTGATCA
AAAAGTACCCTAAGCTGGAAAGCGAGTTCGTGTACGGCGACTACAAGGTGTACGACGTGCGGAAGATGATCGCCAAGA
GCGAGCAGGAAATCGGCAAGGCTACCGCCAAGTACTTCTTCTACAGCAACATCATGAACTTTTTCAAGACCGAGATTA
CCCTGGCCAACGGCGAGATCCGGAAGCGGCCTCTGATCGAGACAAACGGCGAAACCGGGGAGATCGTGTGGGATAAGG
GCCGGGATTTTGCCACCGTGCGGAAAGTGCTGAGCATGCCCCAAGTGAATATCGTGAAAAAGACCGAGGTGCAGACAG
GCGGCTTCAGCAAAGAGTCTATCCTGCCCAAGAGGAACAGCGATAAGCTGATCGCCAGAAAGAAGGACTGGGACCCTA
AGAAGTACGGCGGCTTCGACAGCCCCACCGTGGCCTATTCTGTGCTGGTGGTGGCCAAAGTGGAAAAGGGCAAGTCCA
AGAAACTGAAGAGTGTGAAAGAGCTGCTGGGGATCACCATCATGGAAAGAAGCAGCTTCGAGAAGAATCCCATCGACT
TTCTGGAAGCCAAGGGCTACAAAGAAGTGAAAAAGGACCTGATCATCAAGCTGCCTAAGTACTCCCTGTTCGAGCTGG
AAAACGGCCGGAAGAGAATGCTGGCCTCTGCCGGCGAACTGCAGAAGGGAAACGAACTGGCCCTGCCCTCCAAATATG
TGAACTTCCTGTACCTGGCCAGCCACTATGAGAAGCTGAAGGGCTCCCCCGAGGATAATGAGCAGAAACAGCTGTTTG
TGGAACAGCACAAGCACTACCTGGACGAGATCATCGAGCAGATCAGCGAGTTCTCCAAGAGAGTGATCCTGGCCGACG
CTAATCTGGACAAAGTGCTGTCCGCCTACAACAAGCACCGGGATAAGCCCATCAGAGAGCAGGCCGAGAATATCATCC
ACCTGTTTACCCTGACCAATCTGGGAGCCCCTGCCGCCTTCAAGTACTTTGACACCACCATCGACCGGAAGAGGTACA
CCAGCACCAAAGAGGTGCTGGACGCCACCCTGATCCACCAGAGCATCACCGGCCTGTACGAGACACGGATCGACCTGT
CTCAGCTGGGAGGCGACgctagcATGAGCCGTAGACGAAAAGCGAATCCGACAAAACTGAGTGAAAACGCG
AAGAAGCTTGCCAAGGAAGTTGAAAATTAA