Supplementary figure legends
Figure S1. hFas GBM binds with glycosphingolipids and sulfated polysaccharides and
has high sequence similarity with GBM of other mammalian Fas
A. Molecular model of interaction between the GBM of hFas and LacCer created using Hyperchem software showing the GBM in the hairpin structure interacting with LacCer (upper
panel; Gal, galactose; Glc, glucose; Cer, ceramide backbone) and the stacking between the
residue F134 against the galactose ring of LacCer, rendering the CH- interaction (lower panels), B. The reduction in the  after the injection of hFas GBM peptide (or mutant hFas
GBM peptides with indicated amino acid substitutions) under LacCer monolayer upon increasing initial surface pressures (i) indicates the specific peptide-LacCer binding and a drastic reduction in the binding efficiency with the mutant GBM peptides (represented by the drop
of  at all i examined). C. [3H]-Suramin was incubated in 96-well multiplates coated with
GBM peptides (wild type or indicated mutant at 100 ng/well) and the bound radioactivity was
measured with scintillation counter. Each point corresponds to the mean±SD (n=3). D. Multiple sequence alignment of amino acid stretches covering the cysteine-rich regions of mammalian Fas (human, i; chimpanzee, ii; rhesus monkey, iii; bovine, iv; pig, v; mouse, vi; Norway
rat, vii; cat, viii; dog, ix). The GBM is indicated in dashed box. The position of CRD1-3 of
human Fas is indicated above the alignment.
Figure S2 .Stable mouse T cell lines with equivalent mFas expression and FasL-binding
ability
L12.10.3 cells stably expressing mFas or mutant Fas carrying point mutations F129A, Y130A
or both F129A and Y130A were unstained or stained with FITC-conjugated anti-mFas antibody (JO2-FITC) (A), or were incubated with a series of rhFasL crosslinked with 1 g/ml M2
or M2 alone followed by FITC-conjugated anti-mouse Ig antibody (B), before subjected to
FACS analysis.
1
Figure S3. GBM-defective hFas is FasL-binding competent and can transduce non-death
signal but cannot execute apoptosis
L12.10.3 cells stably expressing hFas.GFP or hFas.GFP with point mutations F134A
(hFas.GFP.F134A) were incubated with 200 ng/ml FasL crosslinked with 1 g/ml M2 or M2
alone followed by the staining with PE-conjugated anti-mouse IgG antibody and then FACS
analysis (A), or were incubated with the indicated amounts of crosslinked FasL for 18 hours
before subjected to cell death assay (B), or were incubated with or without 1 ng/ml FasL
crosslinked with 1 g/ml M2 for an indicated time before the lysates were collected and subjected to SDS-PAGE and immunoblotting with indicated antibodies (C).
Figure S4 Transferrin internalization in L1210.mFas and L1210.mFas.Y130A cells
Cells were subjected to treatments in the presence of serum with indicated amount of MDC (A
and B) or 80 M dynasore (C and D) for 30 minutes, or stably transfected with CHC or control shRNA (E and F), or subjected to the treatment with 4 U/ml cholesterol oxidase (CO) in
the absence of serum for 2 hours (G and H) before analysis of transferrin internalization (see
Supplementary Methods). Note for panels G and H that the serum deprivation that was required during the treatment (with and without cholesterol oxidase) and during the internalization assay may have caused a change in the kinetics of transferrin internalization, possibly due
in part to the modifications of plasma membrane lipid composition.
Supplementary methods
I. Antibodies and reagents
Anti-FADD (Calbiochem), anti-mouse Fas (Abcam), anti-caspase 9 (5B4, MBL), anticaspase-8 (Alexis corporation), anti-ezrin (Zymed Laboratories), anti-phospho- and total
p44/p42 MAPK (Cell Signaling Technology), anti-human Fas (C20), anti-Fyn, anti-Rab5A,
anti-CHC, anti-CALM, and anti-flotillin-1 (Santa Cruz), anti-flotillin-2 (BD Bioscience),
2
horseradish peroxidase conjugated anti-rabbit, anti-mouse, and anti-goat (Jackson ImmunoResearch) antibodies were used for western blotting. Anti-mouse Ig-FITC, anti-mouse IgGphycoerythrin (PE), anti-BrdU, and anti-mouse Fas (JO2)-FITC from BD Bioscience, antiVSV glycoprotein (Sigma) were used for FACS analysis. Biotin-conjugated anti-mouse Fas
(JO2-biotin, BD Bioscience) was used for mouse Fas immunoprecipitation. Mouse anti-Flag
(M2) from Sigma was used for FasL crosslinking. Recombinant human FasL (rhFasL) was
from Alexis Corporation; recombinant extracellular human Fas protein (amino acids 1-157)
from Peprotec; staurosporin, lovastatin, monodansylcadaverine, dynasore, and strepavidinagarose beads from Sigma; protein G sepharose beads from Zymed Laboratories; cholesterol
oxidase from Calbiochem; synthetic Fas peptides from Eurogentec. M2-crosslinked FasL,
goat anti-CHC and anti-CALM (Santa Cruz), Alexa Fluor 488 donkey anti mouse IgG and
Alexa Fluor 555 donkey anti-goat IgG (Invitrogen) were used for immunofluorescence microscopy. LacCer and Gb3 from Sigma, Gb4 from Matreya, GD3, and sphingomyelin from
Alexis were used in the monolayer surface pressure experiments.
II. Constructs
The mFas.F129A, mFas.Y130A, mFas.F129A/Y130A, hFas.F134A, and hFas.F134A.GFP
constructs were obtained from site-directed mutagenesis (Quikchange; Invitrogen) of mFas
(pcDNA3.1.mFas), hFas (pCR3.hFas), and hFas.GFP (pEGFP-N1.hFas) constructs6, respectively. Mouse CHC shRNAi sequence used is:
5’-GATCCCCCACGTGTTATGGAGTATATTTCAAGAGAATATACTCCATAACAC
GTGTTTTTGGAAA-3’.
III. Protein sequences
3
Accession numbers of Fas proteins used for GBM sequence alignment in Fig. 1C are : human
(Homo sapiens P25445), chimpanzee (Pan troglodyte XP_001139138), rhesus monkey
(Macaca mulatta Q9BDP2), bovine (Bos taurus P51867), mouse (Mus musculus P25446),
Norway rat (Rattus norvegicus Q63199),
pig (Sus scrofa O77736), cat (Felis catus
NP_001009314), dog (Canis lupus familiaris XP_543595), Medaka fish (Xenopus tropicalis
ABQ51095), Chicken (Gallus gallus AAG02242), Zebrafish (Danio rerio XP_690447). Accession numbers of TNFR superfamily member proteins (Homo sapiens) used in the Fig. 1D
are : DR4 (O00220), DR5 (O14763), TNFR1 (P19438), DR3 (Q93038), NGFR (P08138),
CD40 (P25942), TNFRP20333LR (P36941).
IV. Surface pressure measurement
The interaction of a peptide (or a protein) with a glycolipid monolayer is an interfacial phenomenon which can be studied by surface pressure () measurements. Namely, the insertion
of the peptide in the glycolipid monolayer can be detected, at constant area, by an increase in
the surface pressure (). This can be followed kinetically by real-time surface pressure
measurements after injecting the peptide into the aqueous subphase underneath the glycolipid
monolayer. Such [ = f(t)] curves allow to calculate the initial velocity of the peptideglycolipid interaction. When the equilibrium is reached, the surface pressure remains stable.
The difference between the maximal (max) and the initial (i) surface pressure values allows
to calculate the maximal surface pressure increase (max) induced by the peptide. The compressibility of glycolipid monolayers generally decreases with increasing surface pressure.
Thus, max is expected to decrease as i increases. The extrapolated i value at which max
= 0 corresponds to the critical pressure of insertion (c). The higher c, the higher the affinity
of the peptide for the glycolipid monolayer. In this respect, [ max = f(i)] curves allow to
compare the respective affinities of wild-type and mutated peptide for a given glycolipid.
4
V. Transferrin internalization
Cells were incubated for 30 min on ice in DMEM supplemented with 5% FBS and 10%
HEPES without or with 50 μg/ml Alexa Fluor488-conjugated transferrin (Molecular Probes;
Tfn-488). The assay was performed in the presence of serum (except in the cholesterol oxidase treatment) due to a significant increase in the sensitivity of the cells toward toxicity of
MDC and dynasore caused by serum deprivation. After washing with ice-cold medium to
remove unbound ligand, cells were incubated at 37°C to restore membrane trafficking for an
indicated time, or left on ice (control; t=0). The membrane trafficking was stopped by adding
ice cold medium and the remaining Tfn-488 on the cell surface was removed by incubating
the cells briefly with ice-cold acid-stripping buffer (50 mM glycine, 100 mM NaCl, pH3).
After washing with ice-cold PBS, cells were analyzed for the remaining Tfn-488 by flow cytometer. The control (t=0) samples that were left on ice were divided into two groups, one
was acid-stripped and another was kept unstripped in order to obtain the total bound Tfn-488
before stripping. To assess the degree of Tfn-488 internalization and recycling, at each time
point, the MFI of the background control cells (untreated with Tfn-488, MFIbackground) was
subtracted from the MFI of the Tfn-488-bound cells (MFITfn) to obtain the absolute fluorescence of Tfn in/on the cells ( MFI abs  MFI Tfn  MFI Background ). The total Tfn bound to the
cells was obtained from the MFIabs of the unstripped control cells that were left on ice at t=0
(MFItotal). The percentage of Tfn-488 that entered and remained in the cells was thus calculated from the MFIabs of the acid-stripped samples relative to the MFItotal, i.e.,
MFI abs, stripped
MFI total
 100 .
5