Supplementary Methods
SNP identification
In the first scan of the entire region, we identified 99 SNPs of which 67 were
informative in the Vietnamese families. Three of these SNPs, located in the IGF2R
region, were not in Hardy-Weinberg equilibrium (HWE) in unaffected parents. For the
PARK2 and PACRG genes, we identified a total of 135 SNPs, 81 of them being
informative in the Vietnamese population (supplementary information, table 1). In the
Vietnamese sample, 78 out of the 81 informative SNPs were in HWE and three
(PARK2_e08(-34), 30kb_target_8_4, PACRG_e07(643)) displayed statistically
significant deviation. Since some of the 67 first-round informative SNPs are contained in
the 81 PARK2/PACRG region SNPs, the total number of informative SNPs across the 6.4
Mb interval families was 129. Of the 19 SNPs associated with leprosy in the Vietnamese
families, 15 SNPs that could be formatted for two Orchid panels were selected for the
replication study in the Brazilian sample. Among the 15 SNPs genotyped in the Brazilian
sample, only one (rs1893540) significantly deviated from HWE. All HWE-deviant SNPs
were disregarded from further analysis.
Sequencing
PCR products for sequencing were obtained in MJ Research PTC-100
thermocyclers under uniform conditions: 20ng of genomic DNA was added to a 50 μL
reaction mixture containing 1.5 mM MgCl2, 0.2 mM dNTPs, 0.1 μM of each primer and
1.0 U of Taq polymerase. The reaction was initiated by denaturing the sample at 96°C
for 5min, followed by 35 cycles of 1min each denaturation at 94°C, primer annealing at
55°C and extension at 72°C. Final extension was done at 72°C for 10min. Sequencing
was carried out at the McGill University and Genome Quebec Innovation Centre on the
ABI 3700 and ABI 3730 DNA analyser platforms as described elsewhere 1. Sequences
were analysed using Sequencing Analysis software version 3.6 (Applied BioSystems,
Foster City, CA) and aligned with Autoassembler 2.1.1 (Applied BioSystems) as well as
the Phred/Phrap/Consed System (http://www.phrap.org/). For comparative sequencing of
the 80 kb haplotype block (chr6:163044521-163124558; 80037 bp), the entire region was
subdivided into 160 segments overlapping that were sequenced individually in each of
the selected individuals. Not sequenced were 3733 bp (4.7%) in the following 11
chromosomal segments: chr6:163057579-163058080 (502 bp); chr6:163066591163066970 (380 bp); chr6:163070649-163070925 (277 bp); chr6:163077595-163078041
(447 bp); chr6:163094575-163095067 (493 bp); chr6:163095617-163096028 (412 bp);
chr6:163099589-163100085 (497 bp); chr6:163104435-163104552 (118 bp);
chr6:163115043-163115097 (55 bp); chr6:163117544-163118049 (506 bp);
chr6:163121534-163121579; (46 bp).
Genotyping
SSCP analysis was performed for marker 30kb_target_3_2_ins. as described in 2.
Genotyping by direct comparative sequencing was performed as described above. Two
PCR fragments containing 4 closely located markers each were sequenced on both
directions in order to obtain the markers genotypes. SNPs PARK2_e01 (-2977),
PARK2_e01 (-3024), PARK2_e01 (-3222) and PARK2_e01 (-3800) were genotyped
using the primers described in 3. Markers PACRG_e07 (345), PACRG_e07 (361),
PACRG_e07 (407) and PACRG_e07 (643) were genotyped using the primers listed on
the supplementary material, table 1. Discordant genotypes observed by replicate
genotyping for markers PARK2_e01 (-697) and 10kb_target_4_1 were re-typed by direct
sequencing.
For the FP platform, PCR primers were designed using the Primer3 software
(http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi). PCR reaction were
carried out as follows: 3.0 ng of genomic DNA were added to an 8.0 μL reaction mixture
containing 2.5 mM of MgCl2, 25 μM of dNTPs, 0.2 U of HotstartTaq DNA polymerase
(Qiagen) and 100 nM of each primer. PCR was initiated by denaturing the samples at
94C for 15 min followed by 45 cycles of denaturation at 94C for 30 sec, annealing at
60C for 30 sec and extension at 72C for 30 sec. Final extension was done at 72C for 6
min. PCR products were treated with Exonuclease I and Shrimp Alkaline Phosphatase as
recommended by the manufacturer (AcycloPrime-FP SNP Detection Kit, Perkin Elmer,
Wellesley, MA). Single-base extension (SBE) detection primers of minimum 16 bp
length and melting temperature above 55°C were designed in one or both orientations for
each SNP using Primer3. FP-SBE reactions were performed in one or both orientations
as suggested by the manufacturer (AcycloPrime-FP SNP Detection Kit, Perkin Elmer,
Wellesley, MA). If necessary, we optimised the FP-SBE reaction by varying the
annealing temperature and MgCl2 concentration. Following the FP-reaction, we
incubated the extension products with single stranded binding protein (USB, Cleveland,
OH). After addition of reading buffer, we read the plates using an Analyst HT reader
(Molecular Devices, Sunnyvale, CA) as described previously 4;5. All PCR and SBE
detection primer sequences are described in the supplementary information, table 1.
For the UHT Orchid platform genotyping, SNP flanking sequences were tested for
the presence of repeats or duplicated regions using the BLAT program
(http://www.genome.ucsc.edu). PCR and SBE primers were designed using the
Autoprimer program (http://www.autoprimer.com). The program selects PCR primers
that will generate products ranging between 90 and 180 bp and an optimized single base-
pair extension primer 5’ to the SNP site 6. The program also assembles SNPs into groups
of twelve by SNP extension type (e.g. T/C, A/T, etc.) and appends a unique DNA tag to
the 5’ ends of the extension primers. Twelve-plex PCR reactions were performed in 384well plates (MJS BioLynx) in a 5 L volume using 6 ng of DNA, 75 M dNTPs, 0.5 U of
AmpliTaq Gold (Perkin-Elmer), and the 24 PCR primers at a concentration of 50 nM
each in 1 X PCR buffer. Thermal cycling was performed in GeneAmp PCR system 9700
thermal cyclers (Applied Biosystems) using the following program: initial denaturation at
95C for 5 min followed by 40 cycles of 95C for 30 sec, 50-55C for 55 sec, 72C for
30 sec. After the last cycle, the reaction was held at 72C for 7 min. Following PCR,
plates were centrifuged briefly and 3 L of a mixture containing 0.67 U Exonuclease I
(Amersham Pharmacia) and 0.33 U Shrimp Alkaline Phosphatase (Amersham
Pharmacia) were added to each well. The plates were sealed and incubated for 30 min at
37C and at 95C for 10 min. Extension reactions and hybridizations to the Orchid UHT
microarray plates were carried out as described in 6, using the SNPware UHT reagent kit
and the appropriate extension mix kit containing two dideoxynuclotides labeled with
either Bodipy-Fluorescein or TAMRA dye (Beckman Coulter). Finally, the plates were
read using the SNPstream Array Imager (Beckman Coulter) and fluorescence intensities
were measured with help of the UHTImage software (Beckman Coulter). Intensities
were plotted and genotypes were called by the UHTGetGenos software (Beckman
Coulter). After visual inspection of the clusters, manual adjustments were made for some
of the assays.
Gene expression analysis
For amplification of GAPDH primers 5'CCTTCATTGACCTCAACTACAT3' and
5'CCAAAGTTGTCATGGATGACC3' were used. PARK2 and PACRG were detected by
PCR amplification using primer pairs
5'CACCTACCCAGTGACCATGA3'/5'CCAGTCATTCCTCAGCTCCT3' and
5'AGACAAGATGCCGAAGAGGA3' /5'GAATCATGCTCAAGGGCAAT 3' located in
PARK2 exons 1 and 2, and PACRG exons 2 and 3, respectively. The genotypes of the
Schwann cell donors are unavailable. The MDM PARK2_e01(-2599) -- rs1040079
haplotypes are: MDM-1 = C--T/C--T; MDM-2 = T--C/C--T; MDM-3 = T--T/T--C.
Statistical methods
For the genomic control study, the median ² value obtained with the 24 control SNPs
was 0.59 leading to a scaling factor of 1.29. Applying this scaling factor did not change
the results of the Brazilian association study since the 9 SNPs out of 13 were still
significant at the 0.05 level, although the tests were less significant. The two main SNPs
(PARK2_e01 (-2599) and rs1040079) were associated with leprosy with pGC<0.003.
Finally, association with the so-called meta-SNP was still strongly significant
(pGC<0.00002).
References
1. Engert, J.C. et al. 5' flanking variants of resistin are associated with obesity. Diabetes 51, 1629-1634
(2002).
2. Mira, M.T. et al. Chromosome 6q25 is linked to susceptibility to leprosy in a Vietnamese population.
Nat Genet 33, 412-415 (2003).
3. West, A. et al. Complex relationship between Parkin mutations and Parkinson disease. Am J Med
Genet 114, 584-951 (2002).
4. Hsu, T.M., Law, S.M., Duan, S., Neri, B.P., and Kwok, P.Y. Genotyping single-nucleotide
polymorphisms by the invader assay with dual-color fluorescence polarization detection. Clin Chem
47, 1373-1377 (2001).
5. Hsu, T.M. et al. Universal SNP genotyping assay with fluorescence polarization detection: SNPstream
UHT: ultra-high throughput SNP genotyping for pharmacogenomics and drug discovery.
Biotechniques: Biotechniques 31. Suppl, 560, (2001).
6. Bell, P.A. et al. SNPstream UHT: ultra-high throughput SNP genotyping for pharmacogenomics and
drug discovery. Biotechniques Suppl, 70-77 (2002).