Supplementary material
Intracellular NAMPT-NAD+-SIRT1 cascade improves post-ischemic vascular repair by modulating Notch signaling in endothelial progenitors
Short title: NAMPT/NAD + regulate EPCs
Pei Wang, 1 * Hui Du, 1,5 * Can-Can Zhou, 1 * Jie Song, 1 Xingguang Liu, 2 Xuetao Cao, 2
Jawahar L. Mehta, 3 Yi Shi, 4 Ding-Feng Su, 1# Chao-Yu Miao 1#
1 Department of Pharmacology, Second Military Medical University, Shanghai, China
2 Institute of Immunology, Second Military Medical University, Shanghai, China
3 Division of Cardiovascular Medicine, University of Arkansas for Medical Sciences,
Little Rock, AR, USA
4 Zhongshan Hospital, Fudan University, Shanghai, China
5 Department of Pharmacy, General Hospital of Lanzhou Military Region, Lanzhou,
China
*These three authors contributed equally to this article .
# Correspondence to Chao-Yu Miao or Ding-Feng Su, MD, PhD,
Department of Pharmacology, Second Military Medical University, 325 Guo He Road,
Shanghai 200433, China
Tel: 86-21-81871271; E-mail: cymiao@smmu.edu.cn or dfsu2008@gmail.com
1

Supplementary Table 1
Sequences of primers for PCR analysis
Gene
Hes1
Sense primer
CGGAATCCCCTGTCTACCTC
Hey1 CCACGCTCCGCCACCAT

-actin ACACCCGCCACCAGTTCG
Anti-sense primer
TCTTGCCCTTCGCCTCTT
CGCCGAACTCAAGTTTCCATT
CCTTCTGACCCATTCCCAC
2

Supplementary Figure 1
Effect of Nampt overexpression on density of VSMCs-coated collateral arterioles in the adductor region. Hindlimb ischemia was performed in WT, Tg and
DN-Tg mice. These mice were anesthetized and the adductor regions were isolated
14 days after ischemia. The density of smooth muscle cell-coated collateral arterioles in the adductor region was evaluated by

-SMA immunohistochemical staining. *
P≤
0.05 versus non-ischemic. # ≤ 0.05 versus WT by two-way ANOVA. n = 6.
3

Supplemental Figure 2
NAD + depletion by FK866 treatment in EPCs. Treatment of NAMPT specific inhibitor FK866 (20 nM) in EPCs for 8 h reduced the NAD+ level. **P≤ 0.01 versus control (CTRL). n = 6
4

Supplemental Figure 3
Upregulation of two Notch ligands (DLL4 and Jagged-1) in bone marrow (BM) of mice subjected with hindlimb ischemia (HLI) and influence of DLL4/Jagged-1 on EPCs proliferation.
A, A model of DLL4-Notch signaling and the inhibitory effect of Notch on VEGFR-2/VEGFR-3 in endothelial cells. B, BM DLL4 was upregulated by
HLI. C , BM Jagged-1 was upregulated by HLI. D, Immobilized Jagged-1 (50 nM) promoted EPCs proliferation while DLL4 (100 nM) induced converse effects.
5

Supplemental Figure 4
Working model of DLL4-Notch signaling in endothelial cells and the expression of DLL4 and Notch in WT and Tg EPCs. A, A model of DLL4-Notch signaling and the inhibitory effect of Notch on VEGFR-2/VEGFR-3 in endothelial cells. B-C ,
Expression of DLL4 in WT and Tg EPCs.
D, Notch expression in WT and Tg EPCs.
NS, no significance. n = 4.
Supplemental Figure 5
Knockdown of SIRT1 using siRNA-mediated RNA interference in cultured EPCs.
Representative image and quantitative analysis of SIRT1 knockdown. * P < 0.01 versus siRNA-scramble. n = 5.
6

Supplemental Materials
Antibodies and agents
All antibodies used for magnetic activated cell sorting (MACS) and fluorescence-activated cell sorting (FACS) were from Miltenyi. Antibody specific for the His (ab58992) and agarose used for immunoprecipitation were from Abcam.
Antibodies specific for C-terminal NAMPT (sc-46440) and CD31 (sc-31045) were from Santa Cruz. Antibody specific for Ki-67 (550609) was from BD Pharmingen.
Antibodies specific PGC1-

was from Cell Signaling Technology Inc. Antibody specific for full-length NAMPT (11776-1-AP) was from Ptglab. Antibody specific for acetylated lysines (4G12) was from Millipore. Antibody specific for

-actin was from
Sigma.
Generation of transgenic mice
NAMPT transgenic mice (Tg mice) and H247A mutant NAMPT transgenic mice
(DN-Tg mice) were generated by our previous method.
1 F1 female C57BL/6N mice were hormonally superovulated and were mated with F1 male hybrids. The next morning, fertilized one-cell eggs were collected from the oviducts and were microinjected, using a microscope, with linearized pIRES2-EGFP vector encoding full-length mouse NAMPT or H247A mutant NAMPT (DN-NAMPT) under control of the ubiquitin promoter. Injected fertilized eggs were transplanted into the oviducts of pseudopregnant F1 hybrids of C57BL/6N mice. Then, founder mice were identified by
PCR assay of genomic DNA from tails of transgenic mice. Founder mice were hybridized with wild-type C57BL/6N mice to produce mice used in all the experiments.
The transgenic mice were identified by PCR amplification of tail genomic DNAs with primers CCCGCCTCGAGAGGAGATATACCATGGGCAG and
GCAACTGCAGCCTAATGAGGTGCCACGTCCT. The primers cover a 1420 bp region in the coding sequence of exogenous NAMPT and DN-NAMPT. The NAMPT cDNA was cloned from mouse liver. The plasmid containing H247A mutant NAMPT was described recently and this mutation inactivated the enzyme activity. 2
7

Measurements of NAD + and SIRT1 activity
The assays for NAD + level and SIRT1 activity were performed as described previously.
4-5 NAD + levels were determined with a NAD + quantification kit (BioVision).
To evaluate the SIRT1 activity, extracts were obtained using a RAPI lysis buffer plus protease inhibitor mix.
Samples were incubated for 10 minutes at 30°C to allow for
NAD + degradation, and incubated for 10 additional minutes with DTT 2 µM. SIRT1 in the tissues lysed by RIPA buffer was enriched by immunoprecipitation using anti-SIRT1 monoclonal antibody (Santa-Cruz) and then subjected to a deacetylation assay using the Fluorimetric Drug Discovery Kit (AK-555, Biomol). Plasma NAMPT protein level was determined by a commercial ELISA kit (EK-003-80, Phoenix
Pharmaceuticals).
EPC quantification
For quantification of EPCs in blood, peripheral blood mononuclear cells (PMBCs) in venous blood were isolated by density-gradient centrifugation with Ficoll
(Amersham-Pharmacia) and then stained with FITC-conjugated Sca-1 antibody and PE-conjugated VEGFR2 antibody to determine the frequency of EPCs
(Sca-1 + /VEGFR2 + ) in the PMBCs by FACS (BD Biosciences).
6 For quantification of
EPCs in bone marrow (BM), the cells from BM were incubated with red blood cell lysis buffer (Sigma) for 15 minutes, and then stained with FITC-conjugated Sca-1 antibody and PE-conjugated VEGFR2 antibody to determine the frequency of
EPCs (Sca-1 + /VEGFR2 + ) by FACS (BD Biosciences).
7
EPC culture
BM cells were harvested. Red blood cells were lysed. EPCs were isolated by the magnetic-activated cell sorting (MACS) bead selection method
(Lineage

/Sca-1 + /Flk-1 + ) according to the manufacturer’s instruction (Miltenyi Biotec,
Bergisch Gladbach, Germany). The BM-derived EPCs were cultured in endothelial cell EBM-2 plus Single Quote medium (Lonza) on flasks coated with bovine
8

fibronectin (Sigma-Aldrich). For testing of EPC phenotype, cells were labeled with Dil acetylated low-density lipoprotein (Dil-ac-LDL, Invitrogen) and Alexa-488-labeled lectin (Invitrogen) for 1 hour. After nuclei staining by DAPI (Invitrogen), the cells were viewed with an inverted fluorescent microscope (Olympus). All experiments were performed at 7-10 days after culture.
EPC proliferation
EPC proliferation assay was performed with a non-radioactive CCK-8 assay (Dojindo,
Japan). Serum starved WT, Tg and DN-Tg EPCs were incubated with endothelial cell medium EBM-2 plus 5% FBS. At different time points, the medium was removed and the cells were washed by PBS for 3 times. Five
 l CCK-8 solution was added into wells and incubated for 2 hours. The optical absorption at 450 nm was obtained with a microtiter plate reader.
EPC migration and chemotaxis
EPC migration was evaluated with reproducible wound assay. This experiment was performed with a pipette tip on a confluent monolayer of EPCs cultured on 24-well plates. The surface of the wound was measured and acquired.
EPC chemotaxis assays were performed in polycarbonate transwell inserts (5µm pore, Corning). The cultured EPCs (1×10 5 ) were seeded in the upper compartment and were cultured at
37°C for 12 h. Then the transwells were placed into a 24-well plate containing EBM-2 plus VEGF (100 ng/ml) as chemoattractant for 24 hours. Migrated EPCs were counted over 3 randomly selected high-power fields in lower chambers.
EPC tube formation
For EPC tube formation assay, Matrigel (BD Bioscience) was added to 24-well plates in the volume of 300 µl and allowed to solidify at 37°C for 30 minutes.
Lineage

/Sca-1 + /Flk-1 + EPCs (3×10 6 ) were then seeded and cultured. After 2 days, the tubes formed from EPCs on the Matirgel were photographed (8 random fields).
9

siRNA transfection
Transfection of siRNA was performed as described previously using Lipofectamine
2000 (Invitrogen) according to the manu facturer’s instructions.
8 At 6 hours after transfection, the medium was replaced to remove the siRNA. At 2 or 3 days after transfection, varieties of assays were performed. The commercial products of siRNA targeting to SIRT1-7 were purchased from Dharmacon (Lafayette, CO, USA).
Quantitative PCR
Quantitative PCR (Q-PCR) was performed with a SYBR green PCR kit (Takara) and
Opticon Monitor 3 Real-time PCR system (Bio-Rad). Single-strand complementary total RNA sample isolated through TRIzol reagent (Invitrogen) and cDNAs were generated by M-MLV reverse transcription (Promega). Fifty nanograms of cDNA were amplified by real-time polymerase chain reaction (RT-PCR) and normalized to beta-actin RNA as an endogenous control. Each reaction was performed in triplicate, and analysis was performed by the 2 −ΔΔ Ct method as described previously.
8 The primers are listed in Table SI .
Immunoblotting, immunoprecipitation and immunochemistry
Immunoblotting was performed in Odyssey Infrared Fluorescence Imaging System
(Li-Cor) as described previously.
5,9 The samples were run in SDS-page, blotted onto nitrocellulose membranes, probed with primary antibody overnight, and then incubated with Infrared-Dyes-conjugated secondary antibodies (Li-Cor). The images were obtained with Odyssey Infrared Fluorescence Imaging System. All immunoblotting experiments were repeated at least three times.
For immunoprecipitation experiments, tissues or cells were homogenated with
RAPI buffer with protease inhibitors (Pierce). To reduce nonspecific binding, 50 μl of normal rabbit serum was added to 1 ml of homogenates and incubated for 1 hour on ice. The G/A agarose was added into the homogenates, and incubated for 1 hour with gentle agitation. The supernatant was incubated with primary antibody at 4°C overnight, and then the protein G/A agarose was added to harvest the expected
10

protein complex with three times wash by lysis buffer. The samples were then separated on 10% SDS-PAGE for immunoblotting.
For immunochemistry experiments, frozen 8μm-thick sections were fixed in 4% paraformaldehyde, blocked by 8% normal goat serum, and incubated in specific primary antibodies as follows: CD31 (1:100), Lectin-IB4 (1:50) and Ki-67 (1:100).
4,10
After being washed three times by PBS, the sections and cells were incubated with
Alexa 488-conjugated or Cy3-conjugated secondary antibodies. Images were obtained by SP5 laser scanning microscope (Leica).
Statistical Analysis
Data were analyzed with GraphPad Prism-5 statistic software (La Jolla, CA). All values are presented as the mean ± SEM. ANOVA was conducted across all investigated groups first. Tukey post-hoc tests were then performed and all 2-group comparisons were made. P < 0.05 was considered statistically significant.
References
1. Wang, C.
, et al.
The E3 ubiquitin ligase Nrdp1 'preferentially' promotes
TLR-mediated production of type I interferon. Nat Immunol 10 , 744-752
(2009).
2. Wang, T.
, et al.
Structure of Nampt/PBEF/visfatin, a mammalian NAD+ biosynthetic enzyme. Nat Struct Mol Biol 13 , 661-662 (2006).
3. Kwon, S.M.
, et al.
Specific Jagged-1 signal from bone marrow microenvironment is required for endothelial progenitor cell development for neovascularization. Circulation 118 , 157-165 (2008).
4. Wang, P.
, et al.
Nicotinamide phosphoribosyltransferase protects against ischemic stroke through SIRT1-dependent adenosine monophosphate-activated kinase pathway. Ann Neurol 69 , 360-374 (2011).
5. Wang, P.
, et al.
Loss of AMP-Activated Protein Kinase-alpha2 Impairs the
Insulin-Sensitizing Effect of Calorie Restriction in Skeletal Muscle. Diabetes 61 ,
1051-1061 (2012).
6. Feng, Y.
, et al.
Human ApoA-I transfer attenuates transplant arteriosclerosis via enhanced incorporation of bone marrow-derived endothelial progenitor cells. Arterioscler Thromb Vasc Biol 28 , 278-283 (2008).
7. Qin, G.
, et al.
Functional disruption of alpha4 integrin mobilizes bone marrow-derived endothelial progenitors and augments ischemic neovascularization. J Exp Med 203 , 153-163 (2006).
11

8. Wang, P.
, et al.
Perivascular adipose tissue-derived visfatin is a vascular smooth muscle cell growth factor: role of nicotinamide mononucleotide.
Cardiovasc Res 81 , 370-380 (2009).
9. Li, Z.Y., Wang, P. & Miao, C.Y. Adipokines in inflammation, insulin resistance and cardiovascular disease. Clin Exp Pharmacol Physiol 38 , 888-896 (2011).
10. Wei, K., Wang, P. & Miao, C.Y. A double-edged sword with therapeutic potential: an updated role of autophagy in ischemic cerebral injury. CNS
Neurosci Ther 18 , 879-886 (2012).
12