HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
Hochschule Mannheim
Lab course GENOMICS
Dipl.-Ing. Ariane Tomsche
Dipl-Ing. Ina Schäfer
Prof. Dr. Chr. Maercker
page
1
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page
2
Safety comments .......................................................................................................................................... 5
Abbreviations................................................................................................................................................. 6
PART I: CLONING AND HYBRIDIZATION ................................................................... 7
1. CLONING OF ZEOCIN IN PUC18 VECTOR............................................................ 7
1.1 AMPLIFICATION OF ZEOCIN AND CREATING OF NEW RESTRICTION ENZYME
SITES ........................................................................................................................... 7
1.1.3 Restriction digest of insert Zeocin and pUC18 with BamHI and EcRI .............................................. 9
1.1.3.1 Purification by Nucleotide Removal (QIAGEN) ............................................................................. 9
1.1.4 ESTIMATION OF CONCENTRATION OF LINEARISED VECTOR AND INSERT
FRAGMENT BY NANODROP AND GEL ELECTROPHORESIS. ................................... 10
1.1.4.1 Check concentration by Nanodrop ............................................................................................. 10
1.1.4.2 Check concentration by gel electrophoresis (see p.33!) .......................................................... 10
1.2 LIGATION OF INSERT (ZEOCIN) AND LINEARISED VECTOR (PUC18) .............. 11
1.3 TRANSFORMATION IN CHEMICALLY COMPETENT CELLS (E.COLI) ................. 12
2. PLASMID MINI PREPARATION USING QIAPREP COLUMNS (QIAGEN) .............. 13
3. FINGERPRINT ........................................................................................................ 14
3.1 SOUTHERN BLOT................................................................................................. 14
3.1.1 Isolation of Genomic DNA by Phenol/Chloroform- Extraction ..................................................... 14
3.1.2 Digestion of genomic and probe DNA ............................................................................................ 14
3.1.3 Southern transfer of the restriction fragments of genomic DNA .................................................... 18
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page
3
3.1.3.1 Denature degisted genomic DNA and positive control on gel ................................................. 18
3.1.3.2 Southern Blot .................................................................................................................................... 18
3.1.3.3 Wash (and cross-link) nylon membrane ...................................................................................... 20
3.2 DIG DNA LABELING AND HYBRIDIZATION ....................................................... 20
3.2.1 Labeling reaction (Random Primed Labeling with DIG-High Prime): ........................................... 21
3.2.2 Set up reaction for estimation of yield of labeled DNA-probe (spot-test) ................................... 22
3.2.3 Immunodetection of DIG labeled DNA ........................................................................................... 23
3.2.4 Hybridization and Probe detection .................................................................................................. 23
3.2.4.1 Hybridization reaction .................................................................................................................... 24
3.2.4.2 Immunodetection/probe detection reaction .............................................................................. 24
PART II: WORKING WITH RNA.................................................................................. 25
4. RNA PREPARATION .............................................................................................. 27
4.1 RNA EXTRACTION OF ANIMAL CELLS WITH RNEASY (QIAGEN) ..................... 27
5. QUANTITY AND QUALITY CONTROL OF RNA ..................................................... 29
5.1 MEASURE RNA CONCENTRATION BY USING NANODROP (PEQLAB) ............. 29
5.2 RNA GEL ELECTROPHORESIS ............................................................................. 29
5.3 TWO STEP QUANTITATIVE REAL TIME PCR (QRT-PCR) ...................................... 30
5.3.1 Synthesis of cDNA using QuantiTect® (QIAGEN) ............................................................................ 30
5.3.2 Quantitative RT-PCR (qRT-PCR) with QuantiFast® (QIAGEN) by Light Cycler® Roche ............... 31
APPENDIX ................................................................................................................ 32
A-1 AGAROSE GEL ELECTROPHORESIS .................................................................. 32
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page
4
A-1.1 DNA-Ladder ....................................................................................................................................... 32
A-1.2 Preparation of agarose gel (DNA) .................................................................................................. 33
A-1.3 Gel Electrophoresis ........................................................................................................................... 34
A-2 USE OF GILSON PIPETS ..................................................................................... 34
A-3 ALTERNATIVE PROTOCOLS ............................................................................... 37
A-3.1 Purification of total RNA from cell lines ........................................................................................... 37
A-3.2 Purification of m-RNA from total RNA .............................................................................................. 37
A-4 DNA ARRAY HYBRIDZATION ............................................................................ 39
A-4.1 One Step cDNA synthesis and labelling reaction ........................................................................ 39
A-4.2 Purifying the Labeled cDNA ............................................................................................................. 40
A-4.3 Manual Hybridization of DNA Arrays .............................................................................................. 41
LITERATURE ............................................................................................................... 43
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page
5
Safety comments
1) Microorganisms

Bacterial strains used during this practical course comply with regulations of the GenTG and are
not able to survive outside the test tube

Avoid contaminations with the organisms
2) Organic solvents

Phenol is the most dangerous organic solvent used in molecular biology

Working with this solvent requires specific care (wear gloves and avoid skin contact etc.)
3) Mutagens / Cancerogens

Ethidium bromid (EtBr) is a very strong mutagen and used to stain DNA

It is absolutely required to wear nitrile gloves when working with this reagent

Take also care for a proper waste management
4) UV radiation

Visualisation of EtBr stained DNA requires UV light

Working with an UV transilluminator requires protection of the eyes (please use plexiglas shields
or specific glasses) and your wrists of UV light (wearing gloves is obvious)

UV light destroys DNA, properly plan your working steps and work without time delay
5) High voltage

Gel electropheresis requires high voltages which can be lethal

Close the lid of the gel equipment before switching on the power supply and switch off the
power supply, when the electrophoresis is finished (before removing the gel)
Furthermore please follow the operating instructions of the autoclaving machines (inactivating of
the organisms modified by genetic engineering (GVO, „gentechnisch veränderte Organismen“),
centrifuges and the instructions of hygiene.
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page
Abbreviations
ATP
Adenosine triphosphate
DNA
Desoxyribonucleic acid
DNAse
Deoxyribonuclease
dNTP
Desoxynucleotide
ddNTP
Didesoxynucleotide
DTT
Dithiothreitol
EB
Elution buffer
EDTA
Ethylenediaminetetraacetat
EtBr
Ethidium bromid
fwd
forward
g
gram
HeLa
Henrietta Lacks breast cancer cells
kb
kilo bases
l
liter
LB
Luria-Broth
LCLC
Human Large Cell Lung Carcinoma
M
molar
mM
millimolar
min
minutes
PIPES
Pierazine-N,N‘-bis(2-ethansulfonic acid)
Mr/MW
molecular weight
ml
milliliter
ori
origin of replication
rev
reverse
rpm
rotations per minute
RNAse
ribonuclease
sec
seconds
SDS
Sodium dodecyl sulfate
SSC
Sodium chlorid / sodium citrate (buffer)
TBE
Tris borate electrophoresis buffer
Tris
Tris(hydroxymethyl)aminomethan
TE
Tris / EDTA (buffer)
v/v
volume per volume
V
Voltage
w/v
weight per volume
Wu
Weiss units
(One Weiss unit is equivalent to approximately 200 cohesive-end ligation units)
6
page
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
Part I: Cloning and Hybridization
1. Cloning of Zeocin in pUC18 vector
1.1 Amplification of Zeocin and creating of new restriction enzyme sites
Vector:
pcDNA3.1/Zeo/CAT (Invitrogen)
Vector size: 5.8 kb
ZeocinTM resistance gene: bases 2972-3346
Primer: Zeo-fw
BamHI
2950
5´ CGC GGATCC cgacaaggtgaggaactaaac
Primer: Zeo-rv
EcoRI
VECTORCARD
3´
3366
5´CGC GAATTC tcgaaatctcgtagcacgtgt 3`
PCR set up for 50 µL add into thin-wall 200µl PCR-tubes:
Tab.1.1. PCR reaction
PCR-components
Endconcentration
Volume µl
5 x Phusion Buffer
1x
10,0
Primer Zeo-forward, 10 pmol/µl
……µM
1,5
Primer Zeo-reverse, 10 pmol/µl
……µM
1,5
dNTP mix (10 mM stock)
200 µM
1,0
Plasmid pcDNA3.1/Zeo/Cat
100 ng
___
H2 O
final volume of 50 µl
___
Phusion (high fidelity polym)(2U/µl) 1,25 units
1,0
Mix and spin shortly and place the PCR reaction tubes in a thermocycler
1.1.1 PCR-Program (Mastercycler Eppendorf) “Zeo”
The following PCR cycle conditions are used
Tab. 1.2. PCR cycle conditions
Step
Temperature
Time
Explanation
1
98°C
30s
Initial Denaturation of DNA-sample
2
98°C
10 s
Denaturation
DNA is denaturated into single strands
3
60°C
20 s
Annealing
primers hybridise (by way of hydrogen bonds)
to their complementary sequences on either
side of the target region
4
72°C
20 s
Elongation extension of complementary DNA
strand from each primer
5
6
7
GoTo step 2 Rep 30
72°C
Hold 4°C
5 min
29 repeats
Final elongation
End of the program
After the reaction, transfer 5µl of the PCR mix into a new tube add 5 µL water and 2 µL 6x
loading dye preparing the sample for the check-gel (will be run on Tuesday)
Purify 45µl of PCR mix by PCR Purification Kit (QIAGEN).
7
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page
8
1.1.2. PCR Purification (QIAGEN)
PCR Purification protocol (QIAquick Spin Handbook 07/2002 )
This protocol is designed to purify single- or double-stranded DNA fragments from PCR and
other enzymatic reactions.
 All centrifuge steps are at 13,000 rpm (~17,900 x g) in a conventional tabletop
microcentrifuge at RT.
1. Transfer 45µL of the PCR Product into a new eppendorf tube.
2. Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
For example, add 500 µl of Buffer PB to 100 µl PCR sample.
3. Place a QIAquick spin column in a provided 2 ml collection tube.
4. To bind DNA, apply the sample to the QIAquick column and centrifuge for 60 s.
5. Discard flow-through. Place the QIAquick column back into the same tube.
Collection tubes are re-used to reduce plastic waste.
6. To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 60 s.
7. Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
IMPORTANT: Residual ethanol from Buffer PE will not be completely removed unless
the flow-through is discarded before this additional centrifugation.
8. Place QIAquick column in a clean labeled 1.5 ml microcentrifuge tube.
9. To elute DNA, add 30 µl Buffer EB (10 mM Tris•Cl, pH 8.5) to the center of
the QIAquick membrane, let the column stand for 5 min, and then centrifuge the column
for 1 min and measure DNA concentration by Nanodrop.
IMPORTANT: Ensure that the elution buffer is dispensed directly onto the QIAquick membrane.
The average elution volume is 28 µl starting with 30 µl elution buffer. The maximum elution
efficiency is achieved between pH 7.0 and 8.5.
Check concentration by Nanodrop
The first one using the Nanodrop has to:
A) Initialize Nanodrop by pipetting 2µl water onto the measuring block
B) Make a blank measurement by pipetting 2µl of reference solution (EB buffer)
The following groups have to:
1) Clean the measuring block with water by a soft paper towel
2) Name your sample (number of your group)
3) Pipet 2µl sample on the measuring block and press the measure button
4) Clean the measuring block with water by a soft paper towel
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page
9
1.1.3 Restriction digest of insert Zeocin and pUC18 with BamHI and EcRI
Calculate the total amount of DNA of your PCR product introduced to the digestion.
Start pipetting sterile ddH2O, then add the buffer and place the DNA in the microfuge tube,
mix an spin shortly.
Finally, add the restriction enzyme. Then incubate the reaction at 37°C for at least 2 hours.
Tab. 1.3. Restriction digest
Restriction digest
Insert Zeocin
pUC18 (2686 bp)
Water
…. µL
…. µL
10x Y-Tango buffer
10 µL
4 µL
Purified PCR product (__ng)
_µL (2 µg)
(endconc. 2x)
DNA
(approx. 26µl)
BamHI (10U/µL)
1 µL
1 µL
Eco RI (10U/µL)
1 µL
1 µL
Total volume
50 µL
20 µL
Incubation at 37°C
2h
2h
Fragment size
….. bp
……. bp
1.1.3.1 Purification by Nucleotide Removal (QIAGEN)
QIAquick Nucleotide Removal Kit Protocol
This protocol is designed for cleanup of fragments and oligonucleotides ≥17 nucleotides from
enzymatic reactions. The protocol ensures removal of primers <10 bases, enzymes, salts, and
unincorporated nucleotides.
• All centrifugation steps are in a eppendorf table top centrifuge at RT.
1. Add 5 volumes of Buffer PN to 1 volume of the reaction sample and mix.
For example, add 250 µl Buffer PN to a 50 µl reaction sample. For DNA fragments ≥100 bp.
2. Place a QIAquick spin column in a provided 2 ml collection tube.
3. To bind DNA, apply the sample to the QIAquick column and centrifuge for 1 min at
6,000rpm.
4. Discard the flow-through and place QIAquick column back into the same tube.
Collection tubes are re-used to reduce plastic waste.
5. To wash QIAquick column, add 750 µl of Buffer PE and centrifuge for 1 min at 6,000rpm.
6. Discard the flow-through and place the QIAquick column back in the same tube, which
should be empty. Centrifuge for an additional 1 min at 13,000 rpm (~17,900 x g).
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page
10
IMPORTANT: Residual ethanol from Buffer PE will not be completely removed unless the flowthrough is discarded before this additional centrifuge.
7. Place the QIAquick column in a clean 1.5 ml microcentrifuge tube.
8. To elute DNA, add 30 µl of prewarmed Elution buffer to the center of the QIAquick
membrane, let the column stand for 5 min, and then centrifuge the column for 1 min at
13,000 rpm
IMPORTANT: Ensure that the water is dispensed directly onto the QIAquick membrane for complete
elution of bound DNA.
Elution efficiency is dependent on pH. The maximum elution efficiency is achieved between pH 7.0 and
8.5.
1.1.4 Estimation of concentration of linearised vector and insert fragment by
Nanodrop and gel electrophoresis.
1.1.4.1 Check concentration by Nanodrop
1) Clean the measuring block with water by a soft paper towel
2) Name your sample (also number of your group)
3) Pipet 2µl sample on the measuring block and press the measure button
4) Clean the measuring block with water by a soft paper towel
1.1.4.2 Check concentration by gel electrophoresis (see p.33!)
In order to estimate the concentration of DNA, see below.
Therefore prepare one 1 %-agarose gel, including GelRed for two groups.
For control of fragment sizes 10µl of 1kb DNA size marker (Fermentas) is used, and for
estimation of concentration a λ-DNA-marker (20ng/µl) of different concentrations (50, 100
und 200 ng)) is loaded on the gel.
Sample preparation, e.g.: 5 µL DNA + 5 µL water + 2 µL loading dye 6x
Samples:
- PCR product …..bp
- pUC18 linearised……..bp
- BamHI – Zeocin – EcoRI ……..bp
- pUC18 uncut…….bp (500ng)
- 1kb DNA ladder (10µL)
- λ-DNA-marker (50/100/200 ng)
- digested purified probe (5µL,5µL water, 2µL 6xloading dye)Exp.3.1.2
Let gel run at 90V (will be done on Tuesday, store samples at -20°C). Analyse by gel imager.
Then calculate and set up ligation reaction (Exp.1.2).
page
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
11
1.2 Ligation of insert (Zeocin) and linearised vector (pUC18)
ng of vector x kb size of insert
insert
x molar ratio of
kb size of vector
vector
= ng of insert
Example:
Ratio of 1:3 (how much 500 bp insert DNA needs to be added to 100 ng of a 3.0 kb vector in a
ligation reaction for a desired vector:insert ratio of 1:3):
100ng vector x 0.5 kb insert
3.0 kb (vector)
3
x
= 50 ng insert
1
1
In this experiment vector:insert ratios of 1:3 is performed as well as one negative control
(ligation of the linearised vector without adding insert DNA), why?. As a positive control 100ng
pUC18 (uncut, circular supercoiled) is transformed into E.coli/DH5alpha, why?. The total
volume of the ligation reaction is 20µl.
Set up ligation reactions in 1.5mL Eppendorftubes :
Tab. 1.4. Ligation reaction
vector:insert ratios of 1:3
negativ control
100ng Vector, linearised
x µl
x µl
Insert fragment
x µl
--
10x Ligase-Buffer
2 µl
2 µl
T4 DNA Ligase (5 Wu/µl)
1,5 µL
1,5 µL
H2 O
x µL
x µL
total volume
20 µL
20 µL
Mix the reaction, spin down shortly and incubate at 16°C overnight .
An inactivation of T4 DNA ligase by 10 min at 65°C is followed next day.
Afterwards follow the protocol given under Exp. 1.3 Transformation in chem. competent cells.
page
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
1.3 Transformation in chemically competent cells (E.coli)
Preheat SOC medium to 42°C
Thaw competent cells (aliquots of 50 - 100µl) and incubate on ice for at least 5 min.
 Add 50 ng of the experimental DNA to one aliquot of cells (here 5 µL of ligation
reaction) prepared as in section 1.2 to one aliquot of competent cells, which are
already in a 1,5 ml tube (work on ice):
Transformation
Ligation reaction
Positiv control:
Negativ control of
reactions
(ratios 1:3)
50 ng pUC18, uncut
ligation reaction
Volume
5 µL
1 µl
(pUC18, cut)
5 µl
Compotent cells
50 µL
50 µl
50 µl
Tab. 1.5 Transformation reaction

Incubate the tube on ice for 30 minutes.
 Heat-pulse the tubes in a 42°C water bath for 90 seconds!.
 Incubate the tubes on ice for 5 minutes.
 Add 0,45 mL SOC media (42°C) to 50 µL competent cells.
 Incubate the tubes at 37°C for 1 h or longer with shaking at 225 rpm.
 Centrifuge 5 min at 5000 rpm and decant supernatant
 Resuspend cells by rest of supernatant and plate transformation mixture on LB agar
plates containing appropriate antibiotic (here Zeozin and /or Amp). Which
transformation reaction do you plate on given diverse LB-Agar-antibiotics plates?
Here: LB-Amp-plates (100µg/mL Amp) for…….
LB-AMP-Zeocin-plates (100µg/mL Amp and 100 µg/mL Zeozin) for…………
Incubate the plates upside down at 37 °C overnight.
The next day inoculate 2 positive colonies of the transformand in LB media with appropiate
resistance:
 Fill 5 ml LB media certain antibiotics in 15ml Falcon tubes (2x)
 transfer each colony in 5mL LB media containing appropriate antibiotics
 incubate at 37°C overnight while shaking at 200rpm (close caps loosly)
Following Exp. 2 Plasmid Mini Preparation according to timetable.
12
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page
13
2. Plasmid Mini Preparation using QIAprep columns (QIAGEN)
Experiment and aim of plasmid preparation
The aim is to isolate recombinant plasmids which have been cloned and transformed into E.
coli in experiment 1. Selected bacterial clones carrying the recombinant plasmid are
inoculated in suitable media and are grown overnight (cloning experiment). The
recombinant plasmid DNA is prepared by plasmid purification using DNA-binding columns
(QIAGEN). By a subsequent restriction enzyme digestion or amplification by PCR the cloned
insert can be isolated and analyzed further.
Material and solutions
P1
50 mM Glucose, 25 mM Tris*Cl pH 8,0, 10 mM EDTA pH 8,0
(autoclave, store at 4 °C)
P2
0,2 N NaOH, 1 % SDS
(make freshly, store at RT)
P3
60 ml 5 M KAc, 11,5 ml acetic acid, 28,5 ml H2O
1. pellet 4mL bacterial culture in 2mL eppendorftube, discard supernatant completely
2. freeze the bacterial pellet at -20°C over night
3. add 250µL resuspension buffer P1, resuspend totally
4. add 250µL lysis buffer P2, invert 6 times thouroughly, incubate 2 minutes at RT
5. add 350µL iced neutralisation buffer N3, invert 6 times thouroughly
6. centrifuge at 13000 rpm for 10 minutes at 4°C
7. carefully decant supernatant into a spin column
8. centrifuge at 13000 rpm for 1 min at RT, discard flow through
9. add 750µL PE wash buffer, centrifuge at 13000 rpm for 1 min at RT, discard fow through
10. centrifuge again at 13000 rpm for 1 min at RT, remove residual wash buffer totally
11. place spin column into sterile 1.5mL microcentrifuge tube, add 50µL Elution Buffer (EB,
37°C) directly onto the center of the column, incubate 5 min
12. centrifuge at 13000 rpm for 1 min at RT to elute DNA
13. measure DNA concentration by nanodrop
14. perform a 10µL restriction digestion using 500ng of DNA and 0.5µL BamHI and XhoI.
Digest at 37°C for 60 minutes and load DNA on a 1% analytial agrose gel including
GelRed (1:10.000).
Sample preparation: 10 µL DNA + 2 µL loading dye 6x
Samples on the gel:
pUC18 uncut, 500 ng
pUC18, digested, 500ng
pUC18-Zeocin , digested (12 µL)
10 µl 1Kb-DNA-Marker
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page
14
3. Fingerprint
3.1 Southern Blot
Experiment and aim
In this experiment, human genomic DNA (placenta) will be cut with EcoRI, HinfI, and MspI
restriction enzymes and separated by gel electrophoresis. The Southern Blot Technique and
Southern hybridization is used to locate and compare the polymorphism sequence of D7S594
or the sequence for the G6PD house keeping gene within the genomic DNA (of diverse
people).
3.1.1 Isolation of Genomic DNA by Phenol/Chloroform- Extraction
Because of the highly toxic reagents Chloroform and Phenol, the genomic DNA is already
prepared and stored at 4°C.
3.1.2 Digestion of genomic and probe DNA
All reactions have to be performed on ice.
a) Digestion of human genomic DNA on (30µL)
Set up 3 restriction digests with 6µg genomic DNA each (different groups will have DNA
extracted from different persons). The genomic DNA is cut ON with 0.5µL EcoRI, HinfI or MspI in
its respective buffer in a total volume of 30µL.
Pipet the 3 different digestion reactions in 3 singular 1,5mL eppendorf tubes as follows (do not
forget to mark the tubes):
Tabelle!
Aqua dest.
__ µl
10x EcoRI Buffer (tube1)/10x HinfI (tube2)/10x Y-Tango (tube3)
3.0 µl
genomic DNA (6µg)
__ µl
EcoRI (tube1)/HinfI (tube2)/MspI (tube3) (ea. 10U/µL)
0.5 µl
final vol.: 30µL
Start pipetting sterile H2Odest.. Then add the 10x buffer (endconc. 1x!) and pipet the DNA into
the microfuge tube. Finally, add the respective restriction enzyme. Afterwards incubate the
reaction at 37°C overnight (ON).
Continue with Exp.3.1.c) Gelelctrophoresis next day.
page
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
15
b) Digest of D7S594 (250bp) or G6PD (120bp) out of TOPO-cloning vectors
(3.9kb)
Digested D7S594 or G6PD DNA (2µg) is needed for probe preparation by DIG labeling after
gel extraction (for step 3.2.1d). Furthermore 150ng of this digested DNA will be load onto the
1.5% agarose gel, serving as positive control for the probe-DNA for the Southern Blot (SB)(for
step 3.2.1c). Groups 1-5: D7S594-TOPO and Groups 6-10: G6PD-TOPO.
Aqua dest.
__ µl
10x EcoRI Buffer
2.0 µl
probe-DNA (2.5 µg)
__ µl
EcoRI (10U/µL)
1.0 µl
final vol.: 20µl
Follow instructions above and digest 2h at 37°C.
After digestion:
separate 70 ng of digested probe-DNA in a new eppi, this should
be the positive control for Southern blot gelelectrophoresis (for
step 3.2.1c). Label your probe!!!!!
Rest of digested probe-DNA is for gelextraction, see step 3.2.1d,
Store samples at -20°C.
c) Gelelectrohoresis of digested genomic DNA
Therefore prepare for southern blot an analytical 1.5% agarose gel (65ml) -two groups/gelSample preparation:
Spin digest, prepare samples with loading dye and load:
-
30µl of digested genomic DNA + 5µl 6x loading dye (LD) (a))
One well free inbetween
70 ng postive control (digested D7S594-TOPO- or G6PD-TOPO- DNA)(b))
+ …..µL water, + …µL 6x LD (endconc. 1x)
20µl of 100bp and 1kb size marker in two different slots
run the gel at 40V for 4 hours (until 2/3 of gel, because of smaller fragments).
stain by EtBr for 5 min and destain by 10 min of MgSO4-solution and analyse by Lumi Imager
Continue with Exp.3.1.3.1 Southern transfer/Denature DNA
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page
16
d) Gelelectrohoresis and Gelextraction of digested DNA sample
Therefore prepare a 1% preparative agarose gel
Sample preparation:
Spin digest, add loading dye and load:
-
….µL of digest of TOPO vector (2-2,5µg) +5µL 6x LD
20µl 1kb size marker
run the gel at 85V for 45 min..
Furthermore, cut desired DNA fragment D7S594 (250bp) or G6PD (120bp) out of the gel and
perform a gel extraction following the instructions of the QIAGEN protocol (alternatively store
gel slice in QG buffer, for volume calculation see below):
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page
17
QIAquick Gel Extraction Kit Protocol (Qiagen)
This protocol is designed to extract and purify DNA of 70 bp to 10 kb from standard or lowmelt agarose gels in TAE or TBE buffer. Up to 400 mg agarose can be processed per spin
column.
 Notes: - The yellow color of Buffer QG indicates a pH ≤7.5.
- Isopropanol (100%) and a heating block or water bath at 50°C are required.
- All centrifugation steps are carried out at 13,000 rpm (~17,900 x g) in a
conventional table-top microcentrifuge at RT.
1. Excise the DNA fragment from the agarose gel with a clean, sharp scalpel.
Minimize the size of the gel slice by removing extra agarose.
2. Weigh the gel slice in a colorless tube. Add 3 volumes of Buffer QG to 1 volume of gel
For example, add 300 µl of Buffer QG to each 100 mg of gel.
3. Incubate at 50°C for 10 min (or until the gel slice has completely dissolved). To help
dissolve gel, mix by vortexing the tube every 2–3 min during the incubation.
IMPORTANT: Solubilize agarose completely.
After the gel slice has dissolved completely, check that the color of the mixture is yellow
(similar to Buffer QG without dissolved agarose).
4. Add 1 gel volume of isopropanol to the sample and mix.
For example, if the agarose gel slice is 100 mg, add 100 µl isopropanol. This step
increases the yield of DNA fragments <500 bp and >4 kb.
5. Place a QIAquick spin column in a provided 2 ml collection tube.
6. To bind DNA, apply the sample to the QIAquick column, and centrifuge for 1 min.
The maximum volume of the column reservoir is 800 µl. For sample volumes of more than
800 µl, simply load and spin again.
7. Discard flow-through and place QIAquick column back in the same collection tube.
Collection tubes are re-used to reduce plastic waste.
8. Add 0.5 ml of Buffer QG to QIAquick column and centrifuge for 1 min.
9. To wash, add 075mL of Buffer PE to QIAquick column, incubate for 3 min and centrifuge
for 1 min.
10. Discard the flow-through and centrifuge the column for an additional 1 min
(be sure that there are no traces of ethanol left)
11. To elute DNA, add 30 µL of Buffer EB or HPLC-water pH7.5 to the center of the QIAquick
membrane, let the column stand for 1 min and then centrifuge for 1 min.
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page
18
Check DNA concentration by Nanodrop and check gel (procedure: see Exp. 1.1.4.2)
Proceed with calculation for Exp.3.2.1 Labeling reaction (DIG High Prime).
3.1.3 Southern transfer of the restriction fragments of genomic DNA
Reagents
Equipment and Supplies
Distilled water
ballpoint pen, disposable gloves
Denaturing buffer
beaker, eg 400 ml, 3MM Whatman,
2xSSC
nylon membrane, flat forceps
10xSSC
paper towels, parafilm strips
Denaturation and transfer buffer: (supplied)
Add the following solids to 700 ml deionized distilled water in a 2-L flask:
20 g NaOH (m.w. 40.00)
0.5M (Final conc.)
Stir to dissolve, preferably using a magnetic bar.
Add water to bring the total solution to 1 liter (1,000 ml).
0,4 M NaOH: (supplied)
2x wash buffer: (supplied)
Add 200 ml 10x SSC and 1mL 10% SDSto 800 ml of deionized distilled water.
Stir to mix.
3.1.3.1 Denature digested genomic DNA and positive control on gel
Wearing gloves, transfer the agarose gel to a small plastic container. Flood the gel with
denaturing buffer (0,4N NaOH). Soak the gel, with occasional agitation, for 5 minutes.
3.1.3.2 Southern Blot
1. Cut a nylon membrane to size of the gel, wear gloves and handle with forceps. Label the
right top corner of the membrane, using a pair of scissors. Wet the membrane by floating
it and then submerging it in a clean container of distilled water.
2. Place the support upside down in the bottom of a large plastic container. Add 500 ml of
0.4M NaOH to the container; the buffer level must be below the top of the gel support.
3. Place one Whatman paper atop the other to form a wick of double thickness, and wet
the wick by submerging in 0.4M NaOH buffer. Center the wet wick on top of the gel
support, with the overlapping ends submerged in buffer.
4. Turn the gel over (with the sample wells facing downwards), and center it on top of the
saturated wick.
5. Place the wet nylon membrane on top of the gel. Align the top edge of the membrane
flush with the bottom edge of the sample wells of the gel or mark slots on the membrane!
page
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
19
Use a plastic pipette to gently push out any air bubbles trapped between the gel and the
membrane. Label the membrane at one corner or at the top provides registration to
orient the hybridized bands on the membrane with the bands in the stained gel.
6. Mask the membrane with four strips of Parafilm. Each Parafilm strip should cover only
about 2mm of one edge of the membrane. The mask must not interfere with the central
area of the membrane containing the DNA fragments.
The mask prevents the wick from directly
contacting the paper towels added and
channels the transfer buffer up through the
central part of the gel containing the DNA
fragments. If the paper towels are cut exactly
to the size of the gel, using the mask will be
unnecessary.
Aligning the membrane with the bottom of the
sample
wells
facilitates
measuring
migration distance of the hybridized bands.
Parafilm mask – Top view
7. Center two wet pieces of gel-sized filter paper on top of the nylon membrane.
8. Center a 5-cm stack of gel-sized paper towels on top of the filter paper.
9. Invert a small plastic container, and place it over the stack of paper towels.
10. Carefully place a 400-ml beaker filled with water on top of the plastic container.
The
weighted
presses
beaker
the
gel/
membrane sandwich, the
filter
paper,
and
the
paper towels into close
contact, thus supporting
capillary flow through the
blotting apparatus.
TRANSFER TAKES PLACE OVERNIGHT.
the
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page
20
3.1.3.3 Wash (and cross-link) nylon membrane
1. Remove the saturated paper towels, the filter paper, and the Parafilm mask from the
blotting set-up.
2. With the nylon membrane still in contact with the agarose gel, label gel/membrane
sandwich, if not done before.
3. Use forceps to peel the nylon membrane from the gel. Transfer the membrane into 20 ml
of distilled water in a small plastic container. Agitate for 1 minute, 2 times.
4. Transfer the membrane to a clean sheet of filter paper, and allow it to air dry for 5 minutes.
5. Sandwich the membrane between two sheets of filter paper.
6. Membranes can be crosslinked with UV light (90 s, 74mW/cm2). Store the membrane at RT.
3.2 DIG DNA Labeling and Hybridization
Experiment and aim
The purified probe (100ng of D7S549 or G6PD) will be labeled with DIG-High Prime mix from
Roche. Estimation of yield follows via immunodetection. The single-stranded DNA probe will
hybridize to its complementary sequence in a sample of genomic DNA. A chemiluminescent
group attached to the probes allows hybridization areas to be visualized.
Material and solution (already prepared)
DNA dilution buffer: hering sperm diluted in TE-buffer, endconc.: 50 µg/mL
TE buffer: 10mM Tris, 1mM EDTA; pH 8.0
Labeled Control DNA: Digoxigenin-labeled pBR328 DNA that has been random primed
according to the standard labeling procedure. The total DNA concentration in the vial is
5µg/ml DIG-labeled DNA.
Anti-Digoxigenin-AP: 750 units/ml Anti-Digoxigenin, Fab fragments from sheep conjugated to
alkaline phosphatase. Dilute the anit-DIG-phosphatase antibody 1:20.000 in 1% blocking
solution
CDP-Star: 25mM Disodium 4-chloro-3-(4-methoxyspirol(1,2-dioxetane-3,2‘(5‘-chloro)tricyclodecan)-4-yl)phenyl phosphate (dilute before use).
CDP-Star is the substrate for alkaline phosphatase. Endconc.: 0,25 mM
For 10 groups: 100µl CDP-Star + 9900µl detection buffer
Washing buffer (Bottle 1; dilute 1:10 with H2O):
100mM maleic acid, 150mM NaCl; pH7.5; 0.3% (v/v) Tween 20.
Maleic acid buffer (Bottle 2; dilute 1:10 with H2O):
100mM maleic acid, 150mM NaCl; pH7.5
Blocking solution (Bottle3; dilute 1:10 with 1x Maleic acid buffer):
1% (w/v) Blocking reagent for nucleic acid hybridisation dissolved in Maleic acid buffer.
Blocking solution is cloudy and should not be filtered. It is stable for at least two weeks when
stored at 4°C, but then it must be brought to room temperature before use.
Detection buffer (Bottle 4; dilute 1:10 with H2O): 100mM Tris-HCL, 100mM NaCl; pH9.5
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page 21
3.2.1 Labeling reaction (Random Primed Labeling with DIG-High Prime):

Measure the concentration of your isolated probe (DNA, experiment 3.1.1) Concentration
should be between 10ng/µL and 100ng/µL (Notice: 10ng-3µg DNA template can be
labeled with this procedure).

Dilute (up to) 300ng of the purified probe in 16µl sterile ddH20, close reaction tube with
parafilm and heat-denature the DNA template in a boiling water bath for 10 min, quickly
chill it on ice (at least 2 min.).

Add 4µl DIG-High Prime (contains all necessary components for random primed labeling:
random hexanucleotide mixture; 1mM dATP, 1mM dCTP, 1mM dGTP, 0.65mM dTTP,
0,35mM alkali-labile DIG-dUTP; 1U/µl Klenow-enzyme; 5x buffer in 50% glycerol)

Incubate the reaction tube at +37°C o.n. (over night) in order to increase the yield of DIGlabeled DNA (see table 3.1).

The reaction can be stopped by freezing at –20°C or chilling on ice (done here).

Due to the given DNA amounts after labeling with DIG-High Prime for 20 h check the
estimated DNA amounts for your labeling reaction (e.g., if the total DNA amount was
approx. 300ng the estimated amounts after labeling would equal approx. 2000ng/20µl =
100ng/µl).
For all labeling reactions, it is extremely important that labeling efficiency is verified in a direct
detection assay (spot test).
Template DNA
1h
20h
10ng
45ng
600ng
30ng
130ng
1050ng
100ng
270ng
1500ng
300ng
450ng
2000ng
1000ng
850ng
2300ng
3000ng
1350ng
2650ng
table 3.1: Yield of DIG-High Prime labeling reaction. Using the DIG-High Prime solution labeling
reactions were performed with increasing amounts of different template DNAs for 1h and
20h.
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page 22
3.2.2 Set up reaction for estimation of yield of labeled probe- DNA (spot-test)

Make a predilution of the DIG-labeled Control DNA by mixing 5µl DIG-labeled Control
DNA with 20µl DNA dilution buffer (final concentration 1ng/µl)- only one group.

Make serial dilutions of the (prediluted) controls according to the appropriate dilution
scheme. Mix thoroughly between the dilution steps.

Use your estimated DNA yields of labeled D7S594 or G6PD probe (refer to table 3.1).
Predilute an aliquot of the newly labeled probe to an expected final concentration of
1ng/µl. (Following the example given by the manufacturers:
Labeling of approx.
300ng template DNA results in approx. 2000 ng/20µl = 100ng/µl labeled DNA. Dilute 1µl
of your labeled DNA in 99µl water, which results in the expected final concentration of
approx. 1ng/µl).

Make serial dilutions of the prediluted (1ng/µl) probe, according to the appropriate
dilution scheme (same as above).

Spot 1µl of the diluted controls on a piece of nylon membrane.
Start with dilution A (100 pg/µl).

In the second row, spot 1µl of the corresponding dilutions of the probe.

Bind the nucleic acids to the membrane by cross-linking with UV light
(90 s; 7.4 mW/cm2).

Wash the membrane (at least the membranes of 2 groups per tray, also for following
steps) in washing buffer for 15 min at room temperature.
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page 23
3.2.3 Immunodetection of DIG labeled DNA

Incubate two membrane in 10mL blocking solution for 30 min at RT in a plastic dish.

Dilute the anti-DIG-alkaline phosphatase 1:20.000 in the blocking solution (already
prepared). Incubate for 30 – 60 min at RT in a sealed plastic bag (use 10 mL).

Wash the membrane twice, 15 min per wash, in 1x wash buffer at RT.

Incubate the membrane in detection buffer (2 min).

Place membrane between two sheets of plastic wrap. Add 1ml of the substrate CDP
(1:100 dilution in detection buffer; 10µl CDP-Star + 990µl detection buffer) and
incubate for 1 min. Expose and analyze signals using the Lumi-Imager (Exposure time
5min).
Estimating the Yield of DIG-labeled DNA. Dilutions of the labeled control DNA and the newly
labeled DNA (in this experiment: G6PD-DNA) were spotted on, bound to, and directly detected on
a nylon membrane with chemiluminescent detection.
3.2.4 Hybridization and Probe detection
The sensitivity limit of DIG-System is 0.03 pg (chemiluminescent detection) homologous DNA in
a Southern blot format on a nylon membrane. This corresponds to the detection of a singlecopy gene in <1µg of human genomic DNA.
Solutions (provided):
Prehybridisation solution: according standard buffer (see instructions by the manufacturer;
supplement / hybridisation techniques) (here “DIG EASY HYB”)
Hybridisation solution: same as above, add DIG-labeled probe
0.1 x wash solution (high stringency): 0.1x SSC, 0.1% SDS (used in this course)
(2 x Wash solution (low stringency): 2 x SSC, containing 0.1% SDS)
(0.5 x Wash solution: 0.5 x SSC, containing 0.1% SDS)
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page 24
3.2.4.1 Hybridization reaction

Place the Southern blot membrane in a hybridization bag containing 5 ml
prehybridisation solution (DIG EASY HYB, pre-warmed).

Seal the bag, and incubate at 42°C up to 2h (at least for 30 min).

Prepare 300ng of labeled probe (either D7S594 or G6PD) by adding 50µl H2O (in a
1.5mL tube) and denaturing DNA in a boiling water bath for 10 min.. Chill immediately
on ice to keep the probe single-stranded (2 min.).
(25ng probe/ml DIG EASY HYB should be used if chemiluminescent detection is
performed).

Discard the prehybridization solution. Seal membrane in a new bag, add 5mL
hybridization solution (prewarmed to 42°C) containing the DIG-labeled, heatdenatured probe. Allow the probe to hybridize by overnight incubation at 42°C (use
either a sealed bag in a shaking water bath (or the hybridization oven with rotating
incubation tubes (35mL hybridization solution) to allow a constant distribution of the
probe throughout the membrane)).

Discard Hybridisation solution (not done in this course: At the end of the hybridization,
the hybridization solution can be collected and frozen. As the hybridization solution
contains surplus DIG-labeled probe the entire solution can be reused 5x in future
experiments .

Wash two times for 5 min. at RT in 2x SSC/0.1%SDS (pre-warmed!) (two groups per tray)

Wash the membrane once for 5 min. in 0.5x SSC/0.1%SDS at 42°C

Wash twice, 15 min per wash in 0.1x SSC, 0.1% SDS at 55°C (pre-warmed!).
3.2.4.2 Immunodetection/probe detection reaction

For immunodetection, incubate the membrane (at least 2 membranes/groups per
tray) in 1x wash buffer (Roche) for 2 min at RT (same procedure as given under “3.2.3
(p. 22)”)

Incubate the membrane in 1x blocking solution for 30 min or longer.

Incubate the membrane with anit-DIG-phosphatase antibody (already prepared
1:20.000 in 1x blocking solution) in a sealed plastic bag for 30 min at RT (2
membranes).

Wash the membrane twice, each wash for 15 min, in 1x wash buffer (Roche).

Equilibrate the membrane (at least 2 membranes per tray) in 1x detection buffer for
2min., transfer the membrane inbetween a plastic wrap and add 0.5ml CDP substrate.
Expose for approx. 2-10 min using the Lumi-Imager and analyse the signals.
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page 25
Part II: Working with RNA
Controlling exogenous ribonuclease activity
To obtain good preparations of eukaryotic mRNA, it is necessary to minimise the activity of
RNases by creating a ribonuclease-free environment. RNases are very stable, active enzymes,
generally they require no cofactors to function. Autoclaving alone is not sufficient to
inactivate RNases.
RNase inhibitors may be added to the protocol at any step, although this is normally not
necessary. If storage of the eluted mRNA is required, addition of an RNase inhibitor at the
elution step is recommended. To avoid degradation of RNA by RNases, work quickly and
wear gloves. To avoid contamination, the following precautions should be taken:
1. Contamination by personnel
Hands are a major source of contaminating RNases. Gloves remain RNase
free only if they do not come in contact with "dirty" glassware and surfaces.
Change gloves frequently when working with RNA.
2. Solutions
Any water and salt solutions used in RNA preparation should be RNase free, i.e.
by treatment with diethylpyrocarbonate (DEPC). This chemical inactivates RNases
by covalent modification. Wherever possible, the solutions should be treated with
0.1% DEPC for at least 1 hour at 37oC and then heated to 100oC for 15 minutes
or autoclaved for 15 minutes to remove any traces of DEPC.
NOTE: Commercially available RNase inhibitors or DEPC cannot be used in buffers containing Tris or
Phosphate and amines, they become consumed; Solutions should be DEPC-treated and
autoclaved before adding Tris. After addition of Tris, the solution should be autoclaved again.
Nucleophiles such as water or ethanol completely convert DEPC to diethylcarbonate. DEPC
should be protected against moisture, before opening bottle should have ambient temperature.
Thermal degradation of DEPC generates ethanol and CO2, and therefore increases ionic strength
and lower pH of not buffered solution.
DEPC is a suspected carcinogen and should be handled with great care. Wear gloves.
3. Plastic and Glassware
Sterile, disposable plasticware is essentially free of RNases and can be used for
preparation and storage of RNA without pre-treatment. General laboratory
plasticware should be rinsed with chloroform. Set aside glassware, plastic ware,
electrophoresis chambers (bleach with H2O2) buffers only for experiments with RNA.
Bake glassware 4h at 300°C (at 200°C overnight), for plasticware use e.g. RNaseZap
(Ambion)
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page 26
We recommend that chemicals for use in RNA isolation and analysis be reserved separately
from those for other uses. Wear gloves when handling labware and reagents, and use only
baked spatulas or better none and untouched weigh boats or weigh paper.
Endogenous RNase
E. RNases are inhibited by guanidinium salts- destroy three dimensional structure of proteins
into coiled state, most powerful is g. isothiocyanate and g. chloride, breaks disulfide bonds
and in presence of a detergent (sarkosyl) disrupt hydrophobic interactions.
Storage of RNA
Purified RNA may be stored at -20°C for a few month or at -70°C in water up to 1 year.
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page 27
4. RNA Preparation
Experiment and aim
Groups with even group numbers will extract total RNA from HeLa cells (human cervical
carcinoma) and other groups prepare total RNA from LCLC cells (large human lung
carcinoma). This RNA will be used in further experiments, e.g. for quantification of expression
of a single gene (experiment 5: qRT-PCR) and for comparative gene expression studies on a
human cDNA Chip (A-4: MicroArray).
4.1 RNA Extraction of animal cells with RNeasy (QIAGEN)
HeLa and LCLC cells were already grown up to 90 % confluency (7x106/eppi), harvested,
disrupted in RLT buffer and stored at -80°C. I.e. you will receive your not homogenized cells,
resuspended in 600µL RLT buffer in a microcentrifuge tube. (Step 1. and 2. of the protocol will
already be done.)
1. Trypsinize and collect cells
(Determine the number of cells.) Aspirate the medium, and wash the cells with PBS.
Aspirate the PBS, and add 0.5ml trypsin in PBS. After the cells detach from dish or flask, add
9.5ml medium (containing serum to inactivate the trypsin), transfer the cells to an RNasefree 15ml Falcon count cells and centrifuge at 300 x g for 5 min. Completely aspirate the
supernatant, and proceed to step 2.
Note: Incomplete removal of cell-culture medium will inhibit lysis and dilute the lysate,
affecting the conditions for binding of RNA to the RNeasy membrane. Both effects may
reduce RNA yield.
2. Disrupt the cells by adding 600µl Buffer RLT
Pipet to mix.
3. Homogenize the lysate following 3a.
START
Note: Incomplete homogenization leads to significantly reduced RNA yields and
can cause clogging of the RNeasy spin column.
3a. Pipet the 350µL lysate (thaw on ice) directly into a QIAshredder spin column placed in a
2ml collection tube, and centrifuge for 2 min at full speed at RT. Repeat once with the rest
of the lysate. Proceed to step 4.
KEEP LYSATE!!!!!
4. Add to the homogenized lysate 1 volume of 70% ethanol (for RNA only), here 600 µL, ,
and mix well by pipetting. Do not centrifuge.
Note: When purifying RNA from certain cell lines, precipitates may be visible after
addition of ethanol. This does not affect the procedure.
5. Transfer up to 700 µl of the sample, including any precipitate that may have
formed, to an RNeasy spin column placed in a 2 ml collection tube (supplied). Close
the lid gently, and centrifuge for 30s at 8000 x g (10,000 rpm) at RT. Discard the
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page 28
flow-through. If the sample volume exceeds 700 µl, load successive sample in the
same RNeasy spin column and centrifuge again. Discard the flow-through after each
centrifugation. *Reuse the collection tube in step 6.
6. Add 700 µl Buffer RW1 to the RNeasy spin column. Close the lid gently, and
centrifuge for 30s at 8000 x g (10,000 rpm) to wash the spin column
membrane. Discard the flow-through.*Reuse the collection tube in step 7.
Note: After centrifugation, carefully remove the RNeasy spin column from the collection
tube so that the column does not contact the flow-through. Be sure to empty the collection
tube completely.
7. Add 500 µl Buffer RPE to the RNeasy spin column. Close the lid gently, and centrifuge
for 30s at 8000 x g (10,000 rpm) at RT to wash the spin column membrane. Discard the flowthrough. Reuse the collection tube in step 8.
8. Add 500 µl Buffer RPE to the RNeasy spin column. Close the lid gently, and
centrifuge for 2 min at 8000 x g (10,000 rpm) to wash the spin column membrane.
The long centrifugation dries the spin column membrane, ensuring that no ethanol
is carried over during RNA elution.
Note: After centrifugation, carefully remove the RNeasy spin column from the collection
tube so that the column does not contact the flow-through. Otherwise, carryover of
ethanol will occur.
9. Place the RNeasy spin column in a new 2 ml collection tube (supplied),
and discard the old collection tube with the flow-through. Close the lid gently, and
centrifuge at full speed for 1 min. Perform this step to eliminate any possible carryover of
Buffer RPE, or if residual flow-through remains on the outside of the RNeasy spin column after
step 8. Make sure the whole column is dry.
10. Place the RNeasy spin column in a new 1.5 ml collection tube (supplied). Add 40µl RNasefree water directly to the spin column membrane and wait for 5 min. Close the lid gently,
and centrifuge for 1 min at 8000 x g (10,000 rpm) to elute the RNA and store on ice!
11. Transfer 5 µL in a RNase-free 1500µL tube (on ice), continue with experiments 5.1 Measure
RNA conc. … and 5.2. RNA gel electrophoresis
12. Following with 5.3.1 Synthesis of cDNA using QuantiTect (Qiagen)
(For alternative protocol see appendix A-3.)
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page 29
5. Quantity and quality control of RNA
Experiment and aim
Quantity of RNA is measured by Nanodrop, following gel electrophoresis is performed for
estimation of RNA quality.
For comparison of gene expression, extracted total RNA from HeLa or LCLC are converted to
complementary DNA (cDNA) by reverse transcriptase (RT-PCR) with QuantiTect Kit (QIAGEN).
Quantitative Real Time PCR (qRT-PCR) is performed to amplify the gene of interest using
synthesized cDNA with gene-specific oligonucleotide primers (here for: G6PD), while
measuring intercalated SYBR Green fluorescence after each cycle (real time) by a Light
cycler intrument (Roche). Therefore quantification of expression of a single gene is possible.
Amplification and labeling is done by QantiFast SYBR Green PCR Kit (qRT-PCR, QIAGEN).
5.1 Measure RNA concentration by using Nanodrop (peqlab)
1. use 2µl DEPC-treated water and initialize Nanodrop, clean surface with a tissue
2. select RNA mode for measuring
3. use 2µl RNase-free water for doing the “blank”, clean surface with a tissue
4. type the name and group of your sample into respective field
5. measure 2µl of RNA sample, clean surface with a tissue
6. type the name and group of next sample into respective field, and so on
7. select “Show Report” and note concentrations. (If the measured concentrations are
much higher than 900ng/µl you may have a contamination of genomic DNA)
8. clean the measuring block (top and bottom)
5.2 RNA gel electrophoresis
Prepare two gelelectrophoresis chambers analytical combs and trays with 0.5% SDS in DEPCwater for 1 h to make them RNase free.
1. prepare 30mL of a 1 % agarose gel in 1x TBE (DEPC-treated, one gel for 6 groups)
2. Fill chamber with 1x TBE in DEPC-treated water
3. dilute ~1000ng of the RNA with 1µl of sterile 5x loading-dye and appropriate _µl DEPCwater, load your RNA, also load 10µL of 1kb ladder
(sizes of rRNA 18S and 28S are 1.9kb and 5.0kb, respectively. )
4. Run gel at 85V for 45 min
5. stain gel for 5 min in freshly prepared ethidium bromide staining solution
6. destain 2 min in freshly prepared 50mM MgCl2
7. take a photo and analyze
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page 30
5.3 Two Step quantitative real time PCR (qRT-PCR)
5.3.1 Synthesis of cDNA using QuantiTect® (QIAGEN)
1. Put your RNA (isolated either from HeLa or LCLC cells) on ice and thaw Kit components: gDNA
Wipeout Buffer, Quantiscript Reverse Transcriptase (contains RNase inhibitor), Quantiscript RT Buffer
(contains dNTPs and MgCl2), RT Primer Mix and RNase-free water at RT). Mix each solution by flicking the
tube.
2. Prepare genomic DNA elimination reaction (work on ice).
Add to a 200 µL sterile PCR tube already prepared with 2µL of gDNA Wipeout Buffer RNA and RNasefree water and prepare genomic elimination reaction according to following table:
Component
Volume /reaction
Final conc.
7x gDNA Wipeout Buffer
2µL
1x
Template RNA
__µL
1.0µg
RNase-free water
__µL
Total volume
14µL
table 5.1: elimination of gDNA contamination
3. Incubate for 4 min at 42°C. Use Mastercycler Program “RTPCR-2”. Place immediately on ice.
Note: do not exceed 10 min. incubation time.
4. Prepare 2 PCR tubes (+/-RT) for the reverse transcription on ice
Master Mix already prepared!
Master Mix component
µl per +RT
µl per - RT
5x Quantiscript RT Buffer : RT
Primer Mix (4 :1)
2.5
2.5
Quantiscript RT
0.5
-
total volume
3.0
2.5
Final conc.
1x
table 5.2: components of +RT and –RT Master Mix for first-strand cDNA synthesis
Mix in one 200 µL tube for +RT reaction:
7µl of RNA template (step 3) and add 3µL +RT Master Mix (already prepared)
in the second 200 µL tube for –RT reaction (as control) mix:
7µl of RNA (step 3) and add 2.5µL –RT Master Mix (already prepared)
5. The recommended temperature profile for QuantiTect® reverse Transcription:
Use Mastercycler Program “RTPCR-3”

20 minutes at 42°C (30 min. for templates longer than 200bp)

3 minutes at 95°C
place reaction on ice immediately and continue with qRT-PCR QuantiFast PCR (5.3.2).
(Alternatively you may store your stable cDNA at -20°C.)
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page 31
5.3.2 Quantitative RT-PCR (qRT-PCR) with QuantiFast® (QIAGEN) by Light Cycler®
Roche
2x SYBR RT Buffer consists of: HotStar Taq Plus DNA Polymerase, 2x solution with SYBR Green dye, dNTPs
and MgCl2.
1. Thaw kit components, template and primers on ice (already done).
2. A master mix is already prepared as listed in table 5.3 without template.
Preparation of SYBR Green master mix
component
concentration
µl per 1 rxn
µl per 2 rxn
10,0
20,0
0,8
1,6
(2µL)
(2µL)
RNase-free water
7,2
14,4
total volume µl
18,0
36,0
final
2 x SYBR PCRMM
1x
10µM FP forward primer +
400 nM
RP reverse primer Mix
400 nM
cDNA template (1-100 ng)
__ng
table 5.3: Master Mix for quantitative reverse transcriptase-SYBR Green labeling
3. Transfer two times 18.0µL master mix in 2 different plastic capillaries sticking in a cooling
block and add 2µL template (+RT or -RT) into respective capillary, seal tightly with a cap and
spin down shortly at 1000 rpm at RT
(only one group will prepare a non template control, water control and a positive standard-10pg).
4. Light Cycler from Roche is programmed as listed below:
Step
PCR
initial
activation
Two-step cycling
Denaturation
Annealing
Time
5 min
Temperature
95°C
Ramp rate
Max./fast mode
10s
30s
95°C
60°C, if Tm≤60°C
Max./fast mode
Max./fast mode
Extension
Number of cycles
10s
35 - 45
72°C
Additional comments
DNA Polymerase activation
Perform fluorescence
collection
data
Number of cycle depends on
amount of template
Settings: Default Channel – 530nm (emission wavelength of SYBR Green)
Seek Temperature – 30°C (looking for samples)
Max. seek position – (depends on the amount of samples)
Instrument Type – 6 channels (up to 6 different fluorescent dyes are detectable)
5. Place capillaries into Light Cycler adapter caroussel and start the programm manually,
name samples and wait until first sample is detected.
(Note: usually for relative quantification an additional internal control for normalization is done using a house
keeping gene e.g. G6PD or GAPDH. In this course, we only monitor a house keeping gene: G6PD.)
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page 32
Appendix
A-1 Agarose Gel Electrophoresis
Material and solutions
Agarose
Ethidium bromide solution (10 mg/ml)
Tape
BioRad Electrophoresis System
Micro wave
UV-Transilluminator + camera
DNA size marker
(Fermentas)
disposable gloves (nitrile, blue)
λ-DNA marker (Fermentas)
50x TAE buffer
242 g Tris-Base, 57.1 ml acetic acid,100 ml 0.5M EDTA (pH 8.0)
add distilled water to 1 L , autoclave, prepare 1x working solution in distilled water
10x TBE buffer
108 g Tris base, 55 g Boric acid, 9.3 g Na4EDTA, add ddH2O to 1 L.
The pH is 8.3 and requires no adjustment.
10x Loading-dye:
5 ml Glycero, 2 ml 0,5 M EDTA pH 7,5, 10mg Bromphenol blue, 10 mg Xylene cyanol, 1 ml 10 %
(w/v)SDS, 2 ml H2O
A-1.1 DNA-Ladder
Fig. A-1: Fermentas DNA-Electrophoresing GeneRuler™ ladders from left: 1 kb, 100bp and λ-DNA ladder
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page 33
A-1.2 Preparation of agarose gel (DNA)
Cast 1% (w/v) agarose gel (volume V is dependend on the size (length L, Band height H) of the
gel casting tray, calculate: V=2/3*L*B*H) and purpose, e.g. an analytical gel for checking DNA
should be thinner than a preparative gel isolating DNA afterwards.
1.
Weigh-in agarose into an Erlenmeyer flask
2.
Add 1x TAE-buffer; heat in a microwave until it boils (watch!) and the agarose is completely
dissolved; cool down solution under running tap water.
3.
Put tray in gel caster and insert a well-forming comb. Carefully pour the agarose solution into
the casting tray to fill it to a depth of about 5mm. The gel should cover only about 1/3 the
height of the comb teeth. Use a pipet tip to move large bubbles or solid debris to the side or
end of the tray, while the gel is still liquid.
4.
The gel will become turbid as it solidifies (in about 10 min.). Take care not to move or jar the
tray while the agarose is solidifying. Touch the corner of the agarose, away from the comb; to
test wether the gel has solified. When the agarose has set, unseal the ends of the casting tray.
5.
Place the tray on the platform of the gel box, so that the comb is at the negative (black)
electrode.
6.
Fill the box with TAE buffer to a level that barely covers the entire surface of the gel. Gently
remove the comb, pulling it straight up and out of the set agarose.
7.
Close the top of the electrophoresis box until use.
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page 34
A-1.3 Gel Electrophoresis
1.
Add respective volume of 6x loading dye to each reaction. Load 10 to 30 µl (depends on the
size of the comb) from each reaction tube into a separate well in the gel. Use a fresh tip for
each reaction! If there is air in the end of the tip, carefully depress the plunger to push the
sample to the end of the tip.
2.
Close the top of the electrophoresis box, and connect the electrical leads to a power supply –
anode to anode (red-red) and cathode to cathode (black-black). Turn the power supply on,
and set it to 100 volts. Current flow can be detected by observing gas bubbles released from
the electrode wires or by the amperes which should register approx. 50-100 mill amperes.
3.
Electrophorese for 30-60 minutes, depending on size of DNA to be separated.
4.
Turn off the power supply, disconnect leads from inputs, and remove the top of the
electrophoresis box. Flood gel with an ethidium bromide solution (0.2-1µg/ml), and allow it to
stain for 10-15 min (150mL TAE buffer + 15µL EtBr).
5.
Wash off excessive EtBr for 5 minutes in 50mM MgCl2-solution.
View under an ultraviolet transilluminator or other UV source. Take a photo at 312 nm (wave length
of the gel documentation system).
A-2 Use of Gilson Pipets
The volumeter consists of three numbers and is read from top to the bottom. The three numbers
indicate the volume selected and are cloured in black and red.
For the P2, P10, P20, P100 and P200 pipettes, the number in black represents microliters and the
number in red represents tenths and hundreths of microliters.
The highest volume is marked on the pushbutton and correspond to the model of the pipette. The
color of the pushbutton correspond to the colour of the tips which have been used for each type
of pipette.
Tab. A-2: Range of pipetting with Gilson Pipets
Model
Colour of tips
Range of pipetting in µL
Price in €uro
P1000
blue
200 - 1000
200
P200
yellow
25 – 200
200
P100
yellow
20 – 100
200
P20
yellow
2 – 20
200
P10
white
1 – 10
250
P2
white
0,2 - 2
250
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page 35
A Push-button
B Operating rod
C Connecting nut
D Ejector
E Tip-holder / disposable
tips
Fig.A-2: Pipetman P / Gilson
Operation
Place an appropriate tip on the shaft of the pipette. Press the tip on firmly using a slight twisting
motion to ensure a positive, airtight seal.
Aspiration
Press the pushbutton to the first positive stop. Holding the pipette vertically, immerse the tip into the
sample liquid. Release the pushbutton slowly and smoothly to aspirate the sample. Wait one
second and then withdraw the tip from the liquid. Avoid touching the orifice of the tip.
Dispensing
Place the end of the tip against the inside wall of the vessel at an angle of 10 to 40 degrees. Press
the pushbutton smoothly to the first stop. Wait one second. Press the pushbutton to the second
stop to expel any remaining liquid. Keeping the pushbutton pressed to the end, remove the
pipette by drawing the tip along the inside surface of the vessel. Release the pushbutton. Eject the
tip by pressing the tip ejector button. It is only necessary to change the tip if a different liquid is
being sampled or if the volumeter setting is changed.
Fig. A-3: Operation (Aspiration and Dispensing)
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page 36
Pre-Rinsing
When pipetting liquids which have a viscosity and density different to water, for example organic
solvents, a film of liquid is formed on the inside wall of the pipette tip. This film can create an error.
Since the film remains relatively constant in successive pipetting operations with the same tip, this
errror can be avoided by forming the film before transferring the first sample. This is done by
aspirating a sample and dispensing it back into the same vessel. Since the film is already formed,
all of the following samples will have better accuracy and repeatability.
This pre-rinsing operation should be repeated when the volume to be aspirated is changed or
when a new tip is used.
Recommendations:
The recommendations below will ensure maximum accuracy and precision from your Pipetman.

Make sure to operate the Pipetman slowly and smoothly.

The depth of immersion in the sample liquid should be the minimum necessary and should
remain constant during aspiration.

The Pipetman should be held in a vertical position.

Change the tip when the volume setting is changed or when a different liquid is to be
aspirated.

Change the tip if a droplet remains on the end of the tip from the previous pipetting
operation.

Each new tip should be pre-rinsed with the liquid to be pipetted.

Liquid should never enter the Pipetman shaft. To prevent this;
-
Press and release the pushbotton slowly and smoothly.
-
Never turn the pipette upside down.
-
Never lay the pipette on its side when there is liquid in the tip.
-
Always use filters with the P5000.

Never grease pistons or seals.

Never force the volumeter beyond its recommended limits.

When pipetting liquids with temperatures different from the ambient temperature, it is
recommended to pre-rine the tip several times before use.

Do not pipette liquids with temperatures above 70°C.

When pipetting acids or corrosive solutions which emit vapours, it is recommended to
disassemble the shaft and to rinse the piston and seal with distilled water after finishing the
pipetting operation.
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page 37
A-3 Alternative protocols
A-3.1 Purification of total RNA from cell lines
Materials
peqGold TriFast (peqLab)
chloroform
75 % EtOH/DEPC H2O
isopropanol
DEPC-H2O
RNAse free tubes, gloves, pipettes, tipps etc.
Protocol:
1.
Homogenize cells in peqGold TriFast (1ml/10 cm 2 dish)
2.
5 min RT
3.
Add 0.2 ml chloroform/ml TriFast
4.
Shake 15 sec
5.
3-10 min RT
6.
5 min 12.000 g (10 min 5000 rpm in Heraeus centrifuge)
7.
Aqueous phase in fresh tube
8.
Add 0.5 Vol. Isopropanol / ml Trifast
9.
5-15 min RT
10. 10 min 12.000 g (20 min 5000 rpm in Heraeus centrifuge), 4°C!
11. Wash pellet twice with 75% EtOH/DEPC-H20 (10 min, 12000 g, 4°C)
12. Airdry pellet
13. Resolve RNA in 50-100 µl DEPC-H20 (5 min 55-60°C)
A-3.2 Purification of m-RNA from total RNA
This step is only necessary, if RT reaction will be done with random primed hexamers only.
BUFFERS AND SOLUTIONS :
Dynabeads Oligo (dT)
5mg beads/ml 1 mg beads bind approximately 2µg poly (A)+ RNA
Binding Buffer:
20 mM Tris-HCl, pH 7.5, 1.0 M LiCl, 2 mM EDTA
Washing Buffer A:
10 mM Tris-HCl, pH 7.5, 0.15 M LiCl, 1 mM EDTA
Elution buffer:
2mM EDTA ( ph 7,5)
Material
Magnetic Particle Concentrator
Dynal MPC- E
NOTE: All reagents used are of analytical grade and RNase-free.
All buffers except the 10 mM Tris-HCl, should be brought to room temperature prior to use. The 10
mM Tris-HCl should be stored on ice or 2-8°C prior to use. Ensure that the Dynabeads Oligo (dT)25
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page 38
have been fully resuspended before use. Resuspend by brief vortexing or pipetting. Check that
your lysis buffer has not precipitated. If any precipitation is observed, please warm to room
temperature and shake to full resuspension.
Protocol:
1. Adjust the volume of your 75 µg RNA to 100 µl with distilled DEPC-treated water or with 10
mM Tris-HCl. This step can be omitted if only a small adjustment is needed.
2. Optimal hybridisation conditions are obtained in Binding Buffer added in a 1:1 ratio
relative to sample volume. If your total RNA is more dilute than 75 µg/100 µl, then simply
add an equal volume of Binding Buffer to the Dynabeads (see point 6 below).
3. Heat to 65oC for 2 minutes to disrupt secondary structures.
4. In the meantime, remove 200 µl of resuspended Dynabeads Oligo(dT)25 from the
stock tube suspension. Dispense the Dynabeads Oligo(dT)25 into a 1.5 ml Eppendorf tube
and place the vial on the Dynal MPC (Magnetic Particle Concentrator).
5. After 30 seconds pipett off the supernatant and wash the Dynabeads
Oligo (dT)25 once. This is done by removing the tube from the magnet,
resuspending Dynabeads Oligo (dT)25 in 100 µl Binding Buffer and placing the tube back
on the magnet.
6. After 30 seconds pipett off the supernatant and remove the tube from the magnet. NOTE: Do
not leave the Dynabeads Oligo (dT)25 unsuspended for a long period, as drying of the Dynabeads may
reduce their efficiency.
7.
Add 100 µl Binding Buffer to the Dynabeads Oligo (dT)25.
8.
Add the total RNA to the Dynabeads Oligo (dT)25 in Binding Buffer.
Mix thoroughly and let stand to hybridize for 3-5 minutes at room temperature.
9.
Place the tube on the magnet for at least 30 seconds or until solution is clear and remove
the supernatant.
10. Remove the tube and wash twice with 200 µl Washing Buffer using the magnet. Be sure to
remove all the supernatant between each washing step. The complete removal of
supernatant is extremely important when working with small volumes.
11. If elution is required, add desired amount (10 - 20 µl or down to 5µl) of 10 mM Tris-HCl. Heat
to 65°C for 2 minutes and place the tube immediately on the magnet. Transfer the eluted
mRNA to a new RNase-free tube.
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page 39
A-4 DNA Array Hybridzation
Experiment and aim
After you have isolated RNA and checked the quality of your RNA preparation, you are ready to
synthesize cDNA. Here we convert and label directly 20µg of total RNA from HeLa or LCLC cells with
different fluorescent nucleotides: Alexa Fluor 555- (HeLa) and AlexaFluor 647-aha-dUTP (LCLC). Labeled ssDNA from two groups (HeLa and LCLC, e.g. groups 1+2), will be hybridized to one cDNA chip, to detect
gene expression diversity in HeLa and LCLC cells.
A-4.1 One Step cDNA synthesis and labelling reaction
1. Mix and briefly centrifuge each component before use.
2. Perform a DNaseI digestion to eliminate genomic DNA
3. In a 1.5ml RNase-free tube, add the following for denaturation:
Component
Final concentration
Volume/reaction
total RNA
20 µg
__ µl
Oligo-(dT)20 primer (2,5µg/µL)
__µM
2.0 µl
RNase-free water
–
__ µl
Total volume
–
15.0 µl
table 7.1: cDNA labeling, denaturation step
4. Incubate tube at 70°C for 10 minutes, and then place on ice for at least 1 minute.
5. Two different mixes are prepared, add correct mix to the tube (step 3) on ice:
Component
Final concentration Volume/reaction
5x first strandBuffer RT
1x
6.0 µl
Or dNTP Mix Alexa Fluor 647-aha-dUTP (LCLC) 1x
3.0 µl
dNTP Mix Alexa Fluor 555-aha-dUTP (HeLa)
(both 10x)
RNase out(40 units/µl)
40 units
1.0 µl
DTT (0.1M)
10 µM
3.0 µl
SuperScript III RT (400 units/µl)
800 units
2.0µL
Total labeling reaction volume
-
30.0 µl
table 7.2: cDNA labeling
6. Mix gently and collect the contents of each tube by brief centrifugation.
Note: After addition of the labeled nucleotides, be careful to minimize exposure of the
tube to light.
7. Incubate tube at 46°C in the dark for 2-3 hours in a shaking waterbath.
Note: A 2-hour incubation is sufficient for generating high-quality labeled cDNA with high
levels of picomole incorporation; however, a 3-hour incubation will result in 10–20% greater
incorporation of labeled nucleotides and more full-length cDNA.
8.
After cDNA synthesis, immediately perform the following hydrolysis reaction
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page 40
to degrade the original RNA:

Add 15µl of 0.1 M NaOH to each reaction tube from Step 6, above. Mix thoroughly.

Incubate tube at 70°C for 30 minutes.

Add 15µl of 0.1 M HCl to neutralize the pH and mix gently.
A-4.2 Purifying the Labeled cDNA
1. Add 700µl of Binding Buffer (prepared with isopropanol) to the reaction tube containing
the labeled cDNA after hydrolysis
2. Clearly label each collection tube and load the cDNA/Binding Buffer solution directly onto
the Spin Cartridge.
3. Centrifuge at 3,300xg (10.000rpm) in a microcentrifuge for 1 minute. Remove the
collection tube and discard the flow-through.
4. Place the Spin Cartridge in the same collection tube and add 600µl of Wash Buffer
(prepared with ethanol) to the column.
5. Centrifuge at maximum speed for 30 seconds. Discard the flow-through.
6. Place the Spin Cartridge in the same collection tube and centrifuge at maximum speed for
30 seconds to remove any residual Wash Buffer. Remove the collection tube and discard.
7. Place the Spin Cartridge onto a new amber collection tube (supplied).
8. Add 20µl of DEPC-treated water to the center of the Spin Cartridge and incubate at RT
for 5 minutes.
9. Centrifuge at maximum speed for 1 minute to collect the purified labelled cDNA. The
eluate contains your purified labeled cDNA.
(The sample can be stored at –20°C for up to one week prior to hybridization. Avoid
freeze/thawing.)
Determine the efficiency of the labeling reaction by using nanodrop:
-
click Micro Array
-
initialize with 1.5µl bidest. water
-
click Blank
-
clean block (top+bottom) with a paper towel
-
Sample Type default is ss-DNA-33, name your sample before making a measurement
-
Measure samples, pipette 2.0µl on the measuring block, click measure
-
clean block (top+bottom) with a paper towel after each measurement
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
Typical Reproducibility
Detection Limit Approximate Upper
Sample Type
(pmol/ul)
Limit (pmol/ul)
0.20
100
0.12
60
Cy3, Cy3.5, Alexa
Fluor 555, Alexa
page 41
(minimum 5 replicates)
(SD= pmol/ul; CV= %)
sample range 0.20-4.0 pmol/ul: ± 0.20 pmol/ul sample range >4.0
pmol/ul: ± 2%
Fluor 660
Cy5, Cy5.5 and
sample range 0.12-2.4 pmol/ul: ± 0.12 pmol/ul sample range >2.4
Alexa Fluor 647
pmol/ul: ± 2%
Table 4.3: Measurement concentration range
Alternatively calculate the yield of cDNA (measured in a conventional spectrophotometer) using
the following formula:
cDNA (ng) = (A260–A320) × 37 ng/µl × volume in µl
Calculate the amount of fluorescent dye using the following formulas:
Alexa Fluor® 555 (pmole) = (A555–A650)/0.15 × volume in µl
Alexa Fluor® 647 (pmole) = (A650–A750)/0.24 × volume in µl
A-4.3 Manual Hybridization of DNA Arrays
1.
Pool 2x 20µL cDNAs from 2 groups that were labeled with Alexa Fluor 555-aha-dUTP or
2.
Alexa Fluor 647-aha-dUTP (cDNA from HeLa and LCLC, e.g. group 1+2=40µL).
3.
Add to the labeled probes 400 µl Buffer (4 µl 10%SDS, 120 µl 20x SSC and 276 µl RNase-free
water) which is necessary for a manual hybridization.
2.
Incubate for 5 min at 95°C.
3.
Adjust to hybridization temperature of 42°C.
4.
Apply a secure seal hybchamber onto the chip, make sure it is leak-proof, pipet the probe
(400µL)into the chamber taking care not to introduce air bubbles. Seal chamber
5.
Place the array in a sealed, dark, humidified chamber (ArrayltTMHybridization Cassette) and
6.
Store slides in the dark until they are scanned (Genepix 4000B Axon Instruments) at the
appropriate wavelength. Remove the seal from the secure seal hybchamber
7.
Sequentially wash the array (400µl each wash at RT)
•
•
•
•
•
2 x 5 min in 2 x SSC
2 x 5 min in 0.1x SSC / 0.1% SDS
2 x 5 min in 0.1x SSC
1 min in ultra pure water
wash with Isopropanol
8.
Dry the slides (by centrifugation, at approximately 1000 rpm for 2 minutes.)
9.
Store slides in the dark until they are scanned (Genepix 4000B Axon Instruments) at the
appropriate wavelength.
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page 42
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page 43
Literature
(1) Gentechnische Methoden, G.Schrimpf, Spektrum Akademischer Verlag
(2) Der Experimentator: Molekularbiologie/Genomics, Mülhardt, Cornel, Spektrum
Akademischer Verlag
(3) Der Experimentator: Microarray, Müller, Röder, Spektrum Akademischer Verlag
(4) http://www.the-scientist.com
HS Mannheim– Lab Course Genomics: Experimental Plan SS2009
page 44