Parent-of-origin allelic contributions to deiodinase-3 expression elicit localized hyperthyroid milieu
in the hippocampus.
Laura J. Sittig1, Laura B. K. Herzing2, Pradeep K. Shukla1, and Eva E. Redei1
1. Department of Psychiatry and Behavioral Sciences, The Asher Center, Feinberg School of
Medicine, Northwestern University, Chicago, IL 60611.
2. Department of Pediatrics, Children’s Memorial Research Center, Feinberg School of Medicine,
Northwestern University, Chicago, IL 60614.
Materials and Methods
Animals. Animal procedures were approved by the Northwestern University Animal Care and Use
Committee. Adult SD and BN male and female rats (70-85 days of age, Harlan, Indianapolis, IN) were
housed in a temperature- and humidity-controlled vivarium with regular light-dark cycles (on at 0600 h,
off at 1800 h). After 1 week of acclimatization, male and female SD and BN rats were mated (n = 6 SD
females, n = 8 BN females) to obtain reciprocal F1 hybrid offspring, F1BS and F1SB, where subscripts are
the first letter of the maternal strain first followed by the first letter of the paternal strain. For the fetal
study, dams were sacrificed by decapitation on gestational day 21 (G21). Additional pregnant dams (BN n
= 7; SD n = 8) were allowed to give birth and rear litters. One or two males and one or two females from
each litter were given behavioral tests after 60 days of age.
Tissue Collection. Pregnant dams were sacrificed by decapitation on G21 between 1000 h and 1200 h, as
previously described [1]. Fetal heads were collected directly into RNAlater reagent (Ambion, Austin, TX,
USA) and kept at room temperature for 24 h before brain regions were dissected and transferred into fresh
RNAlater. Fetal frontal cortices were dissected using a microscope according to the Atlas of Prenatal Rat
Brain Development: A/P (1.0-2.2; M/L 0.0-1.5; D/V 0.0-1.0) [2]. Fetal hippocampal dissections included
the entire structure. Adult offspring were sacrificed by decapitation 2 weeks after the final behavioral test.
Frontal cortex (A/P 5.2-2.7; M/L 0-3.3; D/V 9.0-5.0) and hippocampus were immediately dissected [3].
The left half of each structure was placed on dry ice and the right half was placed into RNAlater. Tissues
were stored at -80C until use.
Morris Water Maze. The Morris Water Maze (MWM) was conducted as described [4] with some
modifications. All sessions were recorded and animals (F1BS n = 18; F1SB n = 16) were tracked using TSE
Videomot 2 software (version 5.75). The program automatically collected data for distance and time in
each quadrant of the maze, or in the outer region near the pool wall for thigmotaxis. Testing was
conducted for 4 trials per day on 4 consecutive days. The platform remained in a constant position at 1 cm
below water level. Three hours following the last trial on day 4, the platform was removed from the tank
and a 60 s probe trial was conducted, for which animals were all placed in the quadrant opposite to the
platform.
Social Interaction. Two weeks after MWM, adult rats (F1BS n = 9; F1SB n = 12) were exposed to juvenile
stimulus pups of 24-28 days of age and the interaction was video-recorded for 4 min. Adults were
individually habituated in a testing cage for 5 min before beginning the first trial. A trained observer
scored olfactory investigation of the adult towards the pup, defined as seconds spent in direct contact.
RNA isolation and Quantitative RT-PCR. Total RNA extraction was performed using Trizol reagent
(Life Technologies, Gaithersburg, MD, USA) according to the manufacturer’s protocol. Genomic DNA
was removed using the TURBO DNA-free kit (Applied Biosystems, Foster City, CA, USA). DNased
RNA (1 ug) was reverse transcribed using the TaqMan Reverse Transcription kit (Applied Biosystems,
Branchburg, NJ, USA). Real-time PCR was conducted with the ABI 7300 system using SYBR Green
Master Mix (Applied Biosystems, Foster City, CA, USA). Dio3 and TRα1 mRNA were quantified
relative to GAPDH RNA. Relative quantification (RQ) was used with the 2 −ΔΔCt method. Dio3 (F1BS n =
10-13/group; F1SB n = 7-8/group) and TRα1 (F1BS n = 5/group; F1SB n = 5/group) qPCR was carried out
with primers as follows: Dio3 F: CTGTTCCCGCGCTTCCTA, R: GTCCCTTGTGCGTAGTCGAG;
TRα1 F: GCTGCTGATGAAGGAGAGAGAAG, R: CAACATGCATTCCGAGAAGCT and GAPDH F:
CAACTCCCTCAAGATTGTCAGCAA, R: GGCATGACTGTGGTCATGA. Results were combined
between plates containing the same calibrator sample.
Pyrosequencing. For pyrosequencing of cDNA samples from F1SB (n = 4-7/brain region/ age group) and
F1BS (n = 11-14/brain region/ age group) offspring, PCR was conducted using forward primer and a
biotinylated
reverse
primer
F:
ATCTGCGTATCCGACGACAAC,
R:
biotin-
TCATGGGCCTGCTTGAAGAA. Purification of biotinylated PCR products and pyrosequencing were
performed by EpigenDx, Inc. (Worcester, MA, USA) using a sequencing forward primer F:
GGCTGTGCACCCTGG. Dio3 allelic ratios were confirmed by standard sequencing. PCR for standard
sequencing was performed using 50 ng cDNA input with primers flanking the SNP between SD and BN
rat strains, F: ATTTCTTGTGCATCCGCAAGC, R: GTACAGCTGCCAAAATTGAGC. The PCR
product was purified from an agarose gel using the Zymoclean Gel DNA Recovery Kit (Zymo Research,
Inc., Orange, CA, USA) and sequencing was performed by ACGT, Inc. (Wheeling, IL, USA) or the
Children’s Memorial Research Center Core Facility (Chicago, IL, USA) using forward and reverse
reaction primers F: CATCCGCAAGCATTTCCT and R: CAAAATTGAGCACCAACG.
T3 Extraction from Brain Regions. Tissue T3 concentrations were determined as described [5]. Briefly,
frontal cortex and hippocampal regions from individual rats (F1BS n = 8; F1SB n = 9) were weighed and
homogenized in 3.5 volumes of 100% methanol containing 1 mM propylthiouracil. T3 was extracted and
concentrations were measured by radioimmunoassay. Assay sensitivity was 18.8 ng/g wet tissue weight
and intra-assay coefficients of variations were 12.9% (frontal cortex) and 14.7% (hippocampus).
Statistics. Data were analyzed first by two-way ANOVA (strain, sex). As there were no sex differences,
male and female data were combined and analyzed by unpaired t-tests (two-tailed). Allelic expression
values derived from pyrosequencing were analyzed by three-way ANOVA (strain, brain region, age)
followed by Bonferroni adjusted post-hoc. Thigmotaxis was analyzed by one-way repeated measures
ANOVA. Data are shown as mean +/- s.e.m. Significance was set at P ≤ 0.05.
Supplementary Figure 1.
Hippocampal-mediated behaviors corroborate the hyperthyroid
hippocampal milieu of F1SB animals. Of the two F1 hybrids, F1SB animals exhibited heightened anxiety
(a) during the first day of Morris Water Maze by showing more thigmotaxis (defined as percent time
spent at the pool wall) [F1,15 = 8.01, P < 0.01] and (b) in the social interaction test by spending less time
investigating a juvenile stimulus pup [t20= 5.25, **P < 0.01]. Thigmotaxis is a measure of anxiety in an
open field or the circular tank of water used in the Morris Water Maze task [6]. Decreased social
interaction in rats has previously been related to a higher anxiety level [7, 8].
(c) F1SB animals also
required more time to locate the platform in the Morris Water Maze probe trial, indicating a working
memory deficit compared to F1BS [t32 = 2.76, **P < 0.01]. There were no strain differences in the latency
to locate the platform on days 1-4 of testing (not shown), indicating that the working memory deficit of
F1SB animals was not due to a spatial learning impairment. One day after the probe trial, rats were given a
visual platform task as control for visuospatial ability. No deficits were present in either group. Error bars
indicate s.e.m.
Acknowledgements
We would like to thank Daniel Schaffer, Brian Andrus, Kanchi Batra, and Kristen Dennis for help in
different aspects of the study. The work was funded by NIH grants RO1 AA017978 and RO1 AA013452
to EER. LS is a predoctoral fellow funded by NIH grant F31 AA018251.
Supplementary References
1.
2.
3.
4.
5.
6.
7.
8.
Sittig LJ, Redei EE. Paternal genetic contribution influences fetal vulnerability to maternal
alcohol consumption in a rat model of fetal alcohol spectrum disorder. PLoS One 2010; 5:
e10058.
Altman J, Bayer S. Atlas of prenatal rat brain development. 1995, Boca Raton: CRC Press.
Paxinos G, Watson C. The rat brain in stereotaxic coordinates. Vol. 3rd edition. 1997, San Diego:
Academic Press.
Wilcoxon JS, Kuo AG, Disterhoft JF, Redei EE. Behavioral deficits associated with fetal alcohol
exposure are reversed by prenatal thyroid hormone treatment: a role for maternal thyroid
hormone deficiency in FAE. Mol Psychiatry 2005; 10: 961-71.
Shukla PK, Sittig LJ, Andrus BM, Schaffer DJ, Batra KK, Redei EE. Prenatal thyroxine treatment
disparately affects peripheral and amygdala thyroid hormone levels. Psychoneuroendocrinology
2010; 35: 791-7.
Barbier E, Wang JB. Anti-depressant and anxiolytic like behaviors in PKCI/HINT1 knockout
mice associated with elevated plasma corticosterone level. BMC Neurosci 2009; 10: 132.
Sala-Roca J, Marti-Carbonell MA, Garau A, Darbra S, Balada F. Effects of dysthyroidism in plus
maze and social interaction tests. Pharmacol Biochem Behav 2002; 72: 643-50.
Darlington CL, Goddard M, Zheng Y, Smith PF. Anxiety-related behavior and biogenic amine
pathways in the rat following bilateral vestibular lesions. Ann N Y Acad Sci 2009; 1164: 134-9.