Two Dimensional Gel Electrophoresis
Purified flagella were solubilised in 400µl of 2D Solubilisation Solution (9M Urea,
2M Thiourea, 2% w/v CHAPS, 1%w/v C7BZ0, 0.2% v/v Biolyte ampholytes pH310, 100mM DTT, trace Orange G) for 2 hours at room temperature with tubes
vortexed every 15 minutes. Solubilised flagella were centrifuged for 10 minutes at
16000g, the resulting supernatant removed and then immediately loaded onto a
17cm IPG strip containing a pH 3-10 gradient (Readystrip, Biorad). IPG strips
were covered with mineral oil and actively rehydrated overnight at 50V in a
Biorad Protean IEF cell prior to isoelectric focusing for 50000 volt-hours. A
maximum voltage of 10000V was applied and the current limited to 50µA per IPG
strip during isoelectric focusing. After focusing was complete, IPG strips were
incubated in Equilibration Buffer 1 (6M Urea, 2% w/v SDS, 0.05M Tris-HCl
pH8.8, 20% v/v Glycerol, 2% w/v DTT) for 15 minutes followed by incubation in
Equilibration Buffer 2 (6M Urea, 2% w/v SDS, 0.05M Tris-HCl pH8.8, 20% v/v
Glycerol, 2.5% w/v Iodoacetamide) for 15 minutes.
The IPG strip was then transferred onto a 10% polyacrylamide gel and fixed into
position using agarose (0.5% w/v in SDS-PAGE running buffer). Second
dimension gels were electrophoresed overnight at 12mA per gel, prior to
overnight staining in Coomassie Brilliant Blue (0.2% w/v Coomassie Blue R250,
50% v/v Methanol, 10% v/v Acetic acid). Gels were destained using two 10
minute incubations in fast destain (50% v/v Methanol, 10% v/v Acetic acid)
followed by incubation in slow destain (10% v/v Methanol,10% v/v Acetic acid)
until spots were clearly visualised and no background staining was observed.
Sample preparation
Following excision of spots or bands from Coomassie-stained gels, samples
were stored at -80°C until digestion in siliconised Eppendorf tubes (BioQuote,
Oxford). Coomassie stain was removed from the gel by washing twice with 25
mM ammonium bicarbonate, 50% acetonitrile (v/v). Following washing, gel
pieces were further dehydrated under vacuum before rehydration with trypsin
solution (sequencing grade, bovine [Roche] or porcine [Sigma], 5-10 µl), at 10 ng
µl-1 in 25 mM ammonium bicarbonate. Samples were allowed to rehydrate for 5
min before overlaying with a sufficient volume of 25 mM ammonium bicarbonate
to completely cover the gel pieces. Digestion was allowed to proceed overnight
at 37°C. When 2D gel separation was employed, a reduction/alkylation step was
performed between dehydration and trypsinolysis. Reduction was performed in
10 mM dithiothreitol, 25 mM ammonium bicarbonate at 60°C for 45 min, followed
by carbamidomethylation using iodoacetamide (55 mM in 25 mM ammonium
bicarbonate), for 1 h at room temperature in the dark. Following
reduction/alkylation, gel pieces were dehydrated again prior to addition of trypsin
solution. Digestion was stopped using 5 µl 0.01% TFA, 50% acetonitrile (v/v),
and the total supernatant was transferred a clean siliconised tube. Further
extraction of peptides from the gel pieces was performed using ca. double the gel
volume of 0.01% TFA, 50% acetonitrile. Pooled extracts from each gel piece
were dried under vacuum.
Sample analysis
Dried samples were dissolved in 6 µl of 0.1% formic acid (v/v) for mass
spectrometric analysis. High performance liquid chromatography (HPLC)electrospray (ESI)-tandem mass spectrometry (MS/MS) analyses were
performed upon an UltiMate/Switchos/Famos nanoflow HPLC (Dionex,
Camberley, Surrey) coupled to a QTof I (Waters, Manchester). Each sample (5
µl) was desalted by injection onto a trapping column (PepMap C18, 300 µm i.d.,
5mm length; Dionex) connected directly to a PepMap C18 analytical column (75
µm i.d., 15 cm length). Samples were separated during 1 h gradients from 590% solvent B (A= 2% acetonitrile, 0.06% formic acid; B= 95% acetonitrile,
0.05% formic acid, (v/v)), at 200 nl/min. Mass spectrometric analyses were
carried out using data-dependent switching between MS and MS/MS acquisition,
with recording of product ion spectra for up to three precursors per cycle. Peak
lists were generated using the PeptideAuto module in MassLynx 3.4 (Waters),
combining all sequential scans from the same precursor, centroiding with a
minimum peak width parameter of 2 and using a peak top parameter of 80%.
Generated files (.pkl) were used as input to the Mascot engine (Matrix Science,
London), as described below.
LC-ESI-MS/MS analyses were additionally performed on a subset of samples
using a Surveyor capillary HPLC coupled to an LTQ mass spectrometer (Thermo
Electron, Hemel Hempstead, Herts). Separations were achieved using a Picofrit
column (75 µm i.d., 10 cm length; New Objectives, Woburn, MA), with 25 min
gradients between 0-90% solvent B at 100 nl/min. Data-dependent analyses
involved a survey scan (m/z 450-1600), followed by narrow m/z-range MS scans
and recording of product ion spectra for the three most abundant candidate
peptide precursor ions. Data were processed and analysed using Sequest
(Thermo Electron) to yield putative protein identifications. Assignments further
assessed by using the same data files (.dta) for Mascot searching.
Mascot searching
Database searching used Mascot version 2.1 on an in-house server (Matrix
Science), against the translated version of the published V4 release of T. brucei
genome sequences
(ftp://ftp.sanger.ac.uk/pub/databases/T.brucei_sequences/T.brucei_genome_v4).
Search parameters included: trypsin with 1 missed cleavage; possible
methionine oxidation; possible cysteine carbamidomethylation (only in cases
where reduction/alkylation was performed); possible cysteine propionamidation;
peptide mass tolerance of 200 ppm; MS/MS mass tolerance of 250 mDa; peptide
charge 2+ or 3+; assumed monoisotopic masses; instrument ESI-QTOF.
Generation of filtered proteomic database
All protein identifications with Mascot scores above the significance threshold
(typically 26-28 for V4 of the T. brucei database) were entered into a preliminary
version of the T. brucei flagellar proteome (TbFP), which was filtered for data
quality using the following criteria. Tentative protein identifications based upon
three or more peptides and with a Mascot score ten or more above threshold
were examined for the quality of their peptide identifications. Where two or more
of the included peptides were identified as the best peptide matches of those
particular masses, and were individually best matched to the cited protein, and
furthermore had highly significant Expectation values (<0.01), then these hits
were accepted into the TbFP without further examination. In cases where these
criteria were not met, the data were subjected to visual assessment and de novo
sequencing. This treatment took into account expert knowledge of peptide ion
fragmentation observed by collision-induced dissociation tandem mass
spectrometry (such as an enhanced propensity for fragmentation of peptide
bonds adjacent to certain residues). In order to substantiate a hit, at least one
sequence tag (typically at least five contiguous residues) was required, uniquely
identifying the polypeptide of interest to a single T. brucei gene (or gene cluster)
using the Genedb motif search tool
(http://www.genedb.org/genedb2/motifSearch?org=tryp). Data were additionally
checked for the presence of contaminating peptides (e.g. trypsin- or keratinderived) by Mascot searching of the NCBInr database to ensure that any
identifying peptide(s) originated from the sample itself and were not artefacts of
sample handling. Where particular proteins were observed in more than one
mass spectrometric experiment, the cumulative sequence coverage was
determined, using only data sets that satisfied the quality criteria cited above.
Model organisms used for bioinformatic analyses
H.sapiens [http://www.ncbi.nlm.nih.gov/genome/seq/HsBlast.html] ; C.reinhardtii
[http://genome.jgi-psf.org/cgi-bin/runAlignment?db=chlre2]; A.thaliana
[http://www.ncbi.nlm.nih.gov/sutils/genom_tree.cgi?organism=euk]; S.pombe
[http://www.ncbi.nlm.nih.gov/sutils/genom_tree.cgi?organism=euk and
http://www.genedb.org/genedb/pombe/blast.jsp] ; C.merolae
[http://merolae.biol.s.u-tokyo.ac.jp/blast/blast.html]; T. brucei
[http://www.genedb.org/genedb/tryp/blast.jsp];
T.cruzi [http://www.genedb.org/genedb/tcruzi/blast.jsp]; L.major
[http://www.genedb.org/genedb/leish/blast.jsp]); (C.elegans
[http://worm.imbb.forth.gr/db/searches/blat]; D.melanogaster
[http://flybase.net/blast/] and P.falciparum
[http://www.plasmodb.org/plasmodb/servlet/sv?page=blast].
Determination of homologues.
Homology was determined by the use of a stringent reciprocal BLASTP (Altschul
et al 1997) protocol. Protein sequences of interest from the query organism were
aligned to all predicted proteins of each target organism using an in-house
BLAST server obtained from NCBI
(http://www.ncbi.nlm.nih.gov/BLAST/download.shtml) with an entry e-value cutoff of 1e-10 and all other settings at default. Where no results were returned the
target organism was considered to have no homologue to the protein of interest
for the purposes of this study (blue ‘x’ in figures). The top hit from each search
was used to search all predicted proteins of the query organism using the same
criteria as before. In order for a protein to be accepted as a homologue (red ‘+’ in
figures) the top hit in the reciprocal BLASTP search had to correspond to the
original protein of interest (or to a protein with 100% sequence identity to the
protein of interest in the case of gene-duplications). Where this was not the case
the target organism was considered to have homologues to the protein of interest
at a second level of confidence (passed e value entry test but failed reciprocal
test, yellow box in figures) but these second-level hits were not considered in the
comparative analyses.
RNAi primers
RNAi fragments were amplified using the following specific primers:
DIGIT: forward
GGTGGGCAAGCTTAATGGAACC, reverse CCTATCACTGCCGCGGAGTGAAACG; MENG: forward
CTGAGCATGAAAGCTTCGATCG, reverse GTACCTGCCCGCGGAGTTTAGTTACC; TbCMRP: forward
GACTGGGTCTTTGGCAAGCTTCATGGC, reverse CCTTTCCGTGAGCCTTGCCGCGGTGCC; HERTS:
forward GGATATATACGGCTGGAAGCTTCCACC; reverse ATCTCCAATGCGGTCCCGCGGGCTTCC;
TbSpef1: forward GCCAAAGCTTGTCGAACTGCATAAC, reverse
ATATCCGCGGAGCTCAGCTATAGTTCG; TbHydin: forward AAGGGTAACGAGGGAACG, reverse
GACGCCGGAAGAAGGAGA; TbPACRG A: forward ATGAGTTACGAGATAC reverse CGTTGCGCAAAT;
TbPACRG B: forward ATGGCGTTCTCACGAA reverse GACGTTAATGAT; TAX-1: forward
CGCGAAGCTTCTGTTAAGCACCTAACC, reverse CGCACCGCGGTATCTCAAACCAAATAC; PFR2 :
forward ATGAGCGGAAAGGAAGTTGAAG, reverse GTCCAAACATCTCCAACGC; TbMBO2: forward
GATGCCCAGAAGGAGC, reverse TTTGAGTCTATCTTGG.
Tomato lectin uptake.
Entry of FITC-conjugated tomato lectin was taken as a marker of endocytic
activity [1, 2]. 106 cells were recovered by centrifugation (5000 x g, 3 min, room
temperature) and re-suspended in 1 ml serum free HMI-9 supplemented with 1 %
w/v bovine serum albumin (BSA) (Sigma #A7511-5G). After incubation at 37oC
for 10 min, cells were collected by centrifugation and re-suspended at 107 cells
ml-1 in serum-free HMI-9 containing 1 % w/v BSA; FITC-conjugated tomato lectin
(Sigma #L0401) added at a dilution of 1/100. After 1 min at 37oC cells were
collected by centrifugation (5000 x g, 3 min, room temperature), washed twice
with 1 ml serum-free HMI-9 containing 1 % w/v BSA, and fixed in 4 % w/v paraformaldehyde in Voorheis’s modified PBS (VPBS, NaCl, 138.9 mM; KCl, 2.68
mM; Na2HPO4, 16 mM; KH2PO4, 3 mM; sucrose, 45.9 mM; glucose, 10 mM; pH
7.4). Fixed cells were air-dried onto slides, slides were washed with -20oC
methanol, rehydrated with PBS (NaCl, 138.9 mM; KCl, 2.68 mM; Na2HPO4,
10.14 mM; KH2PO4, 1.76 mM, pH 7.2) containing 1% w/v glycine, 1% BSA and
mounted with Vectashield containing 4,6 diamidino-2-phenylindole (DAPI)
(Vector Laboratories, Inc.). Images were taken using a Zeiss Axioplan 2
microscope with a 100x 1.4NA lens connected to a CoolSnap HQ CCD camera
(Photometrics).
1
Garcia-Salcedo, J. A., Perez-Morga, D., Gijon, P., Dilbeck, V., Pays, E.
and Nolan, D. P. (2004) A differential role for actin during the life cycle of
Trypanosoma brucei. EMBO J. 23, 780-789.
2
Nolan, D. P., Geuskens, M. and Pays, E. (1999) N-linked glycans
containing linear poly-N-acetyllactosamine as sorting signals in
endocytosis in Trypanosoma brucei. Curr. Biol. 9, 1169-1172.
Anti-221 VSG antibody clearance.
Anti-221 VSG antibody uptake was used as a marker of entry to and endocytosis
from the flagellar pockets. 106 cells were recovered by centrifugation (5000 x g, 3
min, room temperature) and re-suspended in 1 ml serum free HMI-9
supplemented with 1 % w/v with bovine serum albumin (BSA). After incubation
for 10 min at either 37oC or 4oC, a 1/500 dilution of an anti-221 antibody (Many
thanks to J. Bangs for anti 221 VSG antibody [3]) was added and the incubation
continued for a further 5mins. Cells incubated at 37oC were placed in ice for
10mins, collected by centrifugation (5000 x g, 3 min, 4oC), washed twice with ice
cold VPBS (as above), and cells were fixed in 4 % w/v para-formaldehyde in
VPBS. Fixed cells were air-dried onto slides, slides were washed with -20oC
methanol and rehydrated with PBS containing 1% w/v glycine and 1% BSA. A
1/50 dilution of an anti-rabbit fitc conjugate (DAKO) was used to detect anti-221
VSG antibody. After a 1 hour with secondary antibody, slides were washed 5
times with PBS, 5 mins per wash, and mounted with Vectashield containing
DAPI. Images taken using a Zeiss Axioplan 2 microscope with a 100x 1.4NA lens
connected to a CoolSnap HQ CCD camera (Photometrics).
3
Veronica P. Triggs1 and James D. Bangs (2003)
Glycosylphosphatidylinositol-Dependent Protein Trafficking in
Bloodstream Stage Trypanosoma brucei Eukaryot Cell. 2(1), 76-83.