1
Supporting Materials
Antibody and reagent sources
Antibodies were from the following sources: STAT3 (Santa Cruz Biotechnology; Santa Cruz, CA),
phospho-STAT3, phospho-JAK1, total JAK1 and SOCS-3 (Cell Signaling Technology, Inc., Danvers, MA),
HO-1 (Assay Designs, Ann Arbor, MI), Hsc70 (Alpha Diagnostic; San Antonio, TX). Anti-rabbit and antimouse IgG-peroxidase was purchased from Boehringer Mannheim (Indianapolis, IN). LPS from
Escherichia coli serotype 026:B6 (tissue culture-tested, L-2654) was purchased from Sigma; all
experiments were carried out with a single lot of LPS (Lot number 064K4077). gAcrp preparations
contained less than 0.2 ng of LPS/µg of protein. Endotoxin contamination was routinely monitored in the
laboratory using a kinetic chromogenic test based on the Limulus amebocyte lysate assay (Kinetic-QCL,
BioWhittaker, and Walkersville, MD). Recombinant rat IL-10 was purchased from R & D Systems, Inc.
(Minneapolis, MN). Mouse bone marrow nucleofection kit was purchased from Lonza (Cologne,
Germany). PE-conjugated IL-10 RA antibody and mouse IgG1 monoclonal antibodies were purchased
from Abcam (Cambridge, MA). CD16/32 antibody was purchased from eBioscience (San Diego, CA). Zinc
protoporphyrin and Co (III) protoporphyrin IX chloride were purchased from Frontier Scientific, Inc (Logan,
Utah). Rat IL-10 ELISA kit was purchased from Biosource (Camarillo, CA).
Ethanol feeding and Kupffer cell isolation to rats
Rats were allowed free access to the Lieber-DeCarli high-fat complete liquid diet for 2 days. Rats were
then randomly assigned to pair-fed or ethanol-fed groups. Ethanol-fed rats were allowed free access to a
liquid diet containing 17% of the calories from ethanol for 2 days and then a liquid diet containing 35% of
the calories from ethanol for 4 weeks(1). Control rats were pair-fed a liquid diet in which maltose dextrins
were substituted isocalorically for ethanol over the entire feeding period. Kupffer cells were isolated and
cultured as previously described (1, 2). Briefly, isolated Kupffer cells were suspended in CMRL media
with 10% FBS, L-glutamine and antibiotic-antimycotic (CMRL-FBS) at a concentration of 2 x 106 cells/ml.
Cell suspensions were either nucleofected prior to plating or immediately plated onto 96-well (0.2 x 106
cells/well for analysis of mRNA or IL-10 by ELISA) or 24-well (0.75 x 106 cells/well for flow cytometry and
1.0 x 106 Western blot analysis) culture plates.
2
Ethanol feeding to mice
Female C57BL/6 mice were randomly assigned to ethanol- or pair-fed groups. Ethanol-fed mice were
allowed free access to a complete Lieber-DeCarli high fat diet with increasing concentrations of ethanol
(5.5% of calories for 2 days, 11% of calories for 2 days, 22% of calories for 7 days, 27% of calories for 7
days and finally, 32% of calories for 7 days)(3). Control mice were pair-fed diets that isocalorically
substituted maltose dextrins for ethanol. At the end of the feeding protocol, mice were treated with 5
mg/kg CoPP or vehicle (saline) via intraperitoneal injection. Twenty-four hours later, mice were injected
intraperitoneally with 0.7 g LPS/g body weight or an equivalent volume of sterile, endotoxin-free saline
(0.09%). Mice were then anesthetized, livers blanched with saline via the portal vein and excised.
Portions of each liver were then stored in RNAlater (Qiagen, Valencia, CA) and stored at -20oC until
further analysis. Characteristics of the mice are shown in Supplemental Table 1.
siRNA nucleofection in rat Kupffer cells
Following nucleofection, gene expression was analyzed at different times, as indicated in the figure
legends. siRNA were silencer select pre-designed sequences that were validated by Ambion/Applied
Biosystems. Rat HO-1 siRNA sequence: sense 5’-GGA AAA UCC CAG AUC AGC Att-3’ and antisense
5’-UGC UGA UCU GGG AUU UUC Ctc-3’ Rat IL-10 siRNA sequence: sense 5’-GCC UUG UCA GAA
AUG AUC Att-3’ and antisense 5-UGA UCA UUU CUG ACA AGG Ctt-3’. Rat STAT-3 siRNA sequence:
sense 5’ GGC UAA GUU UUG CAA AGA Att-3’ and antisense: 5’ UUC UUU GCA AAA CUU AGC Cca-3’.
Rat AdipoR1 sequences: sense: 5’-UAAUCAGUAGAGCAAUCCCtg-3’ and antisense: 5’-UUUUCUGAG
CCUU AUAUCUgg-3’. Rat AdipoR2 sequences: sense: 5’-AGAUAUAAGGCUCAGAAAAtt-3’ and
antisense: 5’- UUUUCUGAGCCUUAUAUCUgg-3’. Nonspecific siRNA scrambled duplex (sense: 5’GCG CGC UUU GUA GGA UUC G-3’, antisense: 5’-CGA AUC CUA CAA AGC GCG C-3’) were
purchased from Ambion. Efficiency of knock-down was determined by Western blot analysis and qRTPCR, as indicated in the figure legends.
RNA isolation and quantitative real-time PCR
3
RNA was isolated from Kupffer cells using the RNeasy Micro Kit (Qiagen), with on-column DNA digestion
using the RNase-free DNase set (Qiagen) according to the manufacturer’s instructions. RNA from mouse
liver was isolated using RNeasy Mini-kit (Qiagen) . Total RNA (200–300 ng) was reverse-transcribed using
the RETROscript kit (Ambion, Austin, TX) with random decamers as primers. Real-time PCR amplification
was performed in a Mx3000p (Stratagene, La Jolla, CA) using SYBR Green PCR Core Reagents (Applied
Biosystems; Warrington, UK). The primer sequences for rat Kupffer cells were as follows:18S, forward 5’ACG GAA GGG CAC CAC CAG GA-3’ and reverse 5’-CAC CAC CAC CC A CGG AAT CG-3’; TNF-α,
forward 5’-CAA GGA GGA GAA GTT CCC AA-3’ and reverse 5’- CTC TGC TTG GTG GTT TGC TA -3’;
β-actin, forward 5’ CGG TCA GGT CAT CAC TAT CG-3’ and reverse 5’ TTC CAT ACC CAG GAA GGA
AG-3’; HO-1, forward 5’-AGA GTT TCC GCC TCC AAC CA-3’ and reverse 5‘-CGG GAC TGG GCT AGT
TCA GG -3’; and IL-10, forward 5’-ACG CTG TCA TCG ATT TCT CC-3’ and reverse 5’-CGG GTG GTT
CAA TTT TTC AT-3’. Primer sequences for mouse liver were as follows: 18S, forward 5’-ACG GAA GGG
CAC CAC CAG GA-3’ and reverse 5’-CAC CAC CAC CC A CGG AAT CG-3’; TNF-α ,forward 5’ –
CCCTCACACTCAGATCATCTTCT and reverse 5’- GCTACGACG TGGGCTACAG ; HO-1, forward 5’AAGCCGAGAATGCTGAGTTCA and reverse 5’- CGGGTGTAGATATGGTACAAGGA. All primers used
for real-time PCR analysis were synthesized by Integrated DNA Technologies (Coralville, IA) Statistical
analysis of real-time PCR data was performed using ΔCt values.
Supporting Table 1: Characteristics of ethanol- and pair-fed mice (n=4-7 per group).
Pair-fed
EtOH-fed
Pair-fed
EtOH-fed
Pair-fed
EtOH-fed
CoPP treatment
none
none
saline
saline
CoPP
CoPP
LPS treatment
saline
saline
LPS
LPS
LPS
LPS
Initial body weight (g)
17.5 ± 0.5
17.5 ± 0.5
16.93 ± 0.5
17.0 ± 0.3
17.4 ± 0.1
17.4 ± 0.1
Final body weight (g)
21.5 ± 0.8
20.3 ± 0.3
20.3 ± 0.7
18.2 ± 0.5*
20.8 ± 0.5
18.6 ± 0.2*
0.050 ± 0.003
0.053 ± 0.002*
0.046 ± 0.002
0.052 ± 0.001*
0.050 ± 0.002
0.054 ± 0.001*
Liver/body weight
*p<0.05 compared to pair-fed mice in the same treatment group.
4
Supporting Fig. 1. siRNA knock-down of gene expression in primary Kupffer cells. Kupffer cells
isolated from pair- and ethanol-fed rats were transfected or not with 2.0 µg target siRNA or scrambled
siRNA. Efficiency of siRNA knock-down was determined by measuring A) IL-10 mRNA relative to 18S
mRNA (values represent means ± SEM, n=3, +p<0.05 compared to non-transfected cells and cells
transfected with scrambled siRNA) or B) HO-1 protein expression or C) STAT3 protein expression by
Western blot. Hsc70 was used as a loading control. Representative Western blots are shown. D)
Adiponectin receptor 1 (AdipoR1) and E) adiponectin receptor 2 (AdipoR2) mRNA relative to 18S mRNA
(values represent means ± SEM, n=3, +p<0.05 compared to non-transfected cells and cells transfected
with scrambled siRNA).
SUPPORTING REFERENCES:
1.
Aldred A, Nagy LE. Ethanol dissociates hormone-stimulated cAMP production from inhibition of
TNF-alpha production in rat Kupffer cells. Am J Physiol 1999;276:G98-G106.
2.
Kishore R, Hill JR, McMullen MR, Frenkel J, Nagy LE. ERK1/2 and Egr-1 contribute to increased
TNF-alpha production in rat Kupffer cells after chronic ethanol feeding. Am J Physiol Gastrointest Liver
Physiol 2002;282:G6-15.
3.
Roychowdhury S, McMullen MR, Pritchard MT, Hise AG, van Rooijen N, Medof ME, Stavitsky AB,
et al. An early complement-dependent and TLR-4-independent phase in the pathogenesis of ethanolinduced liver injury in mice. Hepatology 2009;49:1326-1334.