Supplementary Material (SM)
Laboratory and Clinical data of patients with MLLmut and MLLwt AML-M5.
Primary blasts from peripheral blood were obtained from a two-month-old patient
with AML-M5 at diagnosis. Caryotyping and FISH analysis revealed a translocation
t(4;11)(q35;q23) with disruption of MLL gene (data not shown). RT-PCR was
negative for MLL-AF4, indicating that another partner gene could be involved in the
rearrangement.
Primary blasts from peripheral blood were obtained from a fourteen-years-old patient
with AML-M5 at relapse. Caryotyping and FISH analysis did not reveal a disruption
of MLL gene (data not shown).
Isolation of CD14+ cells from peripheral blood was performed as follows: peripheral
blood mononuclear cells (PBMNCs) from the patients were isolated by FicollHypaque density gradient centrifugation (1.077 g/cm 3; Ficoll-Paque: Pharmacia Fine
Chemicals, Piscataway, NJ, USA). PBMNCs were then incubated with a monoclonal
antibody to CD14 (specific for monocytes), washed twice. Blasts and monocytes were
isolated by magnetic separation on MACScolumns (Miltenyi Biotec, Germany) using
the procedure recommended by the manufacturer. Purity of the recovered cells
(>95%) was checked by morphology and by immunofluorescence staining.
Cell cycle analysis.
For cell-cycle analysis, cells (1 x 106) were washed in ice-cold PBS and fixed in icecold 70% ethanol in PBS. After washing in PBS, cells were treated with 500 units/ml
RNAse (SIGMA-Aldrich) at 37°C for 5 min. To stain DNA, cells were incubated for
1 h with propidium iodide (PI) (SIGMA-Aldrich) at 50 g/ml in PBS. Analysis was
1
performed by a FACSCalibur flow cytometer (Becton Dickinson, Mansfield, MA,
USA). Data were analyzed by ModFit (Verify Software House, Inc., Mansfield, MA,
USA) software. All experiments were performed in triplicate.
Western blot analysis of histone acetylation.
THP-1, MM6 and MOLM-13 cells (2 x 106) were lysed in 80 l of lysis buffer (50
mM Tris-HCl pH 6.8, glycerol 10%, ß-mercaptoethanol 4%, SDS 1%) sonicated and
centrifuged at 13,000 rpm at 4°C for 20 min. An equal volume of 2x SDS gel-loading
buffer was added to 10 l of supernatant, and the samples were boiled for 3 min. The
proteins were separated by 15% SDS-polyacrylamide gel, transferred to nitrocellulose
transfer membrane (Schleicher & Schuell, Inc., Keene, NH, USA) and probed with a
monoclonal antibody against acetyl-lysine (Upstate Biotechnologies Inc., Lake
Placid, NY, USA), recognizing mainly acetylated histones in cell extracts.
Flow cytometry analysis of differentiation marker antigens. MM6 cells were
plated at a density of 4 x 105/ml in 5 ml RPMI plus 10% FCS. Cells were treated with
either VPA (2mM) alone, ATRA (1M) alone, or VPA (2mM) with ATRA (1M), or
PMA (phorbol-12-myristate-13-acetate)(20nM). All experiments were performed in
triplicate. After incubation at 37°C for 24 h, cells were collected, washed with PBS,
resuspended in 1 ml PBS and then incubated with anti-CD14-PE and anti-CD11b-PE
(Becton Dickinson, San Diego, USA) for 15 min at room temperature in the dark.
Cells were washed, resuspended in 1 ml PBS and analyzed using a FACSCalibur
cytometer (Becton Dickinson). Data for 20 x 103 cells/sample were acquired
immediately and were analyzed using CellQuest software (Becton Dickinson).
The results showed absence of VPA-induced differentiation in MLL-related AML
2
cells. To detect cell differentiation along the monocytic lineage after treatment with
VPA and/or ATRA, changes in expression of CD14 and CD11b antigens were
evaluated by flow cytometry in MM6 (Figure 1 SM) and morphological changes were
evaluated in fresh blasts and in the three cell lines (data not shown). The analysis in
MM6 cells at 24h showed no variation in CD14 and CD11b antigens after treatment
with VPA and/or ATRA, while treatment with the differentiative agent PMA
increased the level of expression of both CD14 and CD11b antigens. No
morphological sign of monocytic differentiation change was observed in the blasts or
THP-1, MM6 and MOLM-13 cells after treatment with VPA and/or ATRA.
3
Figure 1 (SM). (a) Analysis of cell differentiation along the monocytic lineage using
flow cytometry for the evaluation of changes in expression of CD14 and CD11b
antigens in MM6 cells 24h after treatment with VPA and/or ATRA and PMA. (b)
Triplicate data from independent experiments are expressed in mean ± SD; stars
depict statistical difference (p<0.05) between control and treatment. Mean
fluorescence intensity (MFI).
4
Microarray hybridization and analysis.
Total RNA was extracted from THP-1 cells treated or not with VPA (2 mM) and/or
ATRA(1 M) after 6h, 24h and 48h using a combination of the Trizol (Invitrogen,
Carlsbad, USA) and the RNeasy Mini-Kit (QIAGEN, Santa Clarita, USA). Cells were
arvested and washed with PBS, for 5 min at 300 x g. Pellet was resuspended in 1-2 ml
of Trizol. Cell suspension was vortexed for 15-20 sec after addition of 0.2 volumes of
chloroform. Samples were centrifuged at 12000 x g for 15 min at +4°C; the
supernatant was transferred into a new vial and 1 volume of ethanol 70% was added
while vortexing at low speed. The mix was centrifuged twice at 3000 x g for 5 min at
R/T, in a RNeasy mini column. The column was washed at 3000 x g for 5 min, once
with 700 l of RW1 buffer and twice with 500 l of RPE buffer. RNA was eluted
with 30 l of Rnase- free water, at 3000 x g for 5 min. Total RNA was quantified
using spectrofotometer (Beckman-Coulter). Each time point is representative of two
biological experiments and two chips array. cDNA was synthesized from 15g Total
RNA using the Superscript II RT cloning kit (Life Technologies, Rockville,
Maryland, USA). An in vitro transcription was performed on this cDNA to synthesize
biotin-labelled cRNA using a available kit (Enzo Diagnostic, New York, USA ). After
a purification step with the RNeasy Mini-Kit, 15g cRNA was used for hybridization
to Human Genome U95Av2 GeneChip (Affimetrix, Santa Clara, USA) according to
the manufacturer's protocol.
Microarray analysis was performed according to the manufacturer’s protocol using
the Human Genome U95Av2 GeneChip, which represents 12,625 human genes.
Scanned output files were visually inspected for hybridization artefacts and then
analysed with the Affimetrix Microarray Suite 5.0 software. A threshold of two-fold
5
change in gene expression from the control was considered. Each time point was
representative of a duplicate independent experiment of the cultured cells, each
biological replicate coming from a different batch. Hence, 12 different experimental
points were generated for each batch, using control untreated cells and cells treated
with VPA and/or ATRA, respectively. Arrays were scaled (in accord with the
Affimetrix Microarray Suite 5.0 analysis) to an average intensity of 500 and analysed
independently. To perform comparison analysis for each couple of array replicates
(each replicate coming from a different batch), each experiment was normalized
(Affimetrix Microarray Suite 5.0) to its control chip obtaining two couples
experiment-control chip for each experimental point. Absolute analysis and
comparison analysis was performed on each replicate independently. A sequence of
four high stringency boolean filters on calls were used to select a confident set of
changed genes. (i) A filter on presence calls was applied in order to exclude genes
called “absent” in both replicates. (ii) A second filter on change calls was applied in
order to exclude genes called “Not Changed” in both replicates with respect to control
chips. (iii) A third filter was applied to obtain consistence between presence and
change calls: genes presenting a trend in the presence call in contradiction with the
change call label in at least one of the replicate (pattern such as Absent – Present
Decreased or Present –Absent -Increased) were excluded. (iv) A final filter on change
call was applied in order to exclude genes with opposite change labels between the
replicates.
For the biological classification of genes changed, the GeneOntology (GO)
classification (http://www.geneontology.org) was used to cluster annotated U95Av2
genes for functional categories. Gene categories were chosen by browsing one of the
three main terms of the ontology vocabulary: Biological Process. In many cases,
6
single genes were associated with multiple identifiers for each main GO term. The
EASE package,3 was used for a rapid biological interpretation of gene lists and to
assign a statistical significativity to the categories of biological process that resulted
changed from the analysis of microarray. Significantly, over-represented functional
categories (p < 0.05) for each list were identified using EASE scores corrected for
multiplicity using 1000 bootstrap iterations.
7
Figure 2 (SM). (a) Number of Affimetrix probesets up- and down-regulated in THP-1
cells after 6h, 24h and 48h of treatment with VPA (V) and/or ATRA (A). (b)
Diagrams representing the overlaps among genes changed in THP-1 cells after
treatment with VPA and/or ATRA.
8
Figure 3(SM). Biological categories of genes principally modulated by VPA (V)
and/or
ATRA
(A)
in
THP-1.
The
Gene
Ontology
(GO)
database
(http://www.geneontology.org) was used to cluster annotated U95Av2 genes for
functional categories. The EASE package,3 was used for a rapid biological
interpretation of genes and to assign a statistical significativity to the categories of
biological process affected.
9
Antibodies and primers used for ChIP analysis
Used antibodies were: N-Imm – non-immune rabbit IgG (Cedarlane, Hornby,
Canada); Ac-H3 and Ac-H4 – specific to acetyl-histones H3 and H4 (Upstate).
Primers for real-time RT-PCR used to amplify ChIP-recovered DNA were specific to
the promoter regions of p21 and CG2; exon 1 of MyoD and a consensus repeat of
chromosome 2 alpha-satellite DNA (sat) were used as negative controls of
acetylation:
GTGGGAATAGAGGTGATATTG/ACACAGCACTGTTAGAATGAG (p21);
ATCAGCGTGCTAAGTTTTTAT/ATGCTACAAGTTTGGGTATTT (CG2);
CGCTTTCCTTAACCACAAATC/AAACACGGGTCGTCATAGAAG(MyoD);
AGACAGAAGCATTCTCAGGAA/CTTTTTCATCATAGGCCTCAA (sat).
References.
1 Rocchi P, Tonelli R, Camerin C, Purgato S, Fronza R, Bianucci F et al.
p21Waf1/Cip1 is a common target induced by short-chain fatty acid HDAC
inhibitors (valproic acid, tributyrin and sodium butyrate) in neuroblastoma cells.
Oncol Rep 2005; 13: 1139-1144.
2 Khobta A, Carlo-Stella C, Capranico G. Specific histone patterns and
acetylase/deacetylase activity at the breakpoint-cluster region of the human MLL
gene. Cancer Res 2004; 64: 2656-2662.
3 Hosack DA, Dennis G Jr, Sherman BT, Lane HC, Lempicki RA. Identifying
biological themes within lists of genes with EASE. Genome Biol 2003; 4: R70.
10