Tritsch E. et al Supplementary material and methods and figures.
SUPPLEMENTARY MATERIAL AND METHODS AND FIGURES FOR
An SRF/miR-1 axis regulates NCX1 and Annexin A5 protein levels in the normal and
failing heart
Eva Tritsch1, Youssef Mallat1, Florence Lefebvre2,3, Nicolas Diguet1, Brigitte Escoubet4,5,
Jocelyne Blanc1, Leon De Windt6, Daniele Catalucci7,8, Grégoire Vandecasteele2,3, Zhenlin
Li1, Mathias Mericskay1¶
Detailed material and methods section
Transgenic mice
Double transgenic mice bearing the α-MHC-MerCreMer transgene and SRF floxed (Sf/Sf)
alleles were obtained as described previously (1). Mice were maintained in C57BL/6
background form more than 20 generations. SRF inactivation in adult mouse heart was triggered
by intraperitoneal injections of tamoxifen diluted in peanut oil ((25 mg/kg/day,Sigma-Aldrich
Inc., Saint Louis, MO), from day (D) 1 (first injection) to D4. SRF-floxed mice injected with
tamoxifen were used as controls unless specified otherwise in the legend (see online figure V).
Transgenic mice overexpressing miR-1 in the heart were generated as described in details
elsewhere (Catalucci, submitted manuscript). Briefly, the targeting construct for inducible miR-1
expression was generated by cloning of a DNA fragment containing the Tet operon, the minimal
CMV promoter, the miR-1 sequence, and a termination sequence-PolyA. The vector was
injected into fertilized mouse eggs and transgenic integration was determined by Southern
blotting analysis of genomic DNA. Positive founder mice (F0) were crossed with mice
expressing the reverse tetracycline-responsive transcriptional activator rtTA under the control of
the cardiac-specific α-Myosin Heavy Chain (α-MHC). Double transgenic mice (Tg) were
backcrossed for six generations into the C57Bl/6J strain background. Induction of cardiacspecific expression of miR-1 in Tg mice was obtained by administration of doxycycline (dox) in
their food pellet (400 mg/l).
1
Tritsch E. et al Supplementary material and methods and figures.
Phenylephrin administration
For phenylephrine (PE) treatment, micropumps (Alzet 2002 Osmotic Pumps, Cupertino, CA) set
up to deliver (R)-(-) Phenylephrine
hydrochloride (Sigma P6126-5G) at 80mg/kg/day or
containing vehicle buffer only (PBS, 0,002% ascorbic acid) were implanted under the back skin
into 5 animals for each group, controls and mutants each, at D10 under 2% Isofurane (Abbott,
Rungis, France), 2% in oxygen] anesthesia. After 5 minutes, absence of pain reaction was
verified by repeated pinching of the limb pad.
AntagomiR administration
Cholesterol linked antagomiRs obtained from Fidelity Systems (Gaithersburg, USA) were
injected at 20 mg/kg in 12 week-old CR57BL6/N mice by a single injection in the saphenous
vein under 2% Isofurane (Abbott, Rungis, France), 2% in oxygen] anesthesia.
AntagomiR-1:
mU*mA*mCmAmUmAmCmUmUmCmUmUmUmAmCmAmUmU*mC*mC*mA*-Chol
Negative control antagomiR with minimal sequence identity to mouse miRNAs :
mU*mC*mAmCmAmAmCmCmUmCmCmUmAmGmAmAmAmGmAmG*mU*mA*mG*mA
*-Chol
where * = phosphorothioate linkage; m = 2’-O-methyl modified; Chol, cholesterol linked though
a hydrocy-prolinol residue)
Echocardiography
Echocardiography was performed under light anesthesia [ 1% Isofurane, in oxygen] with a
Toshiba Power Vision 6000 (SSA 370A; Toshiba, Tokyo, Japan) ultrasound machine equipped
with a linear 8–14 MHz transducer. Body temperature was maintained with a heating pad. In
basal characterization of WT and SRFHKO mice, LV dimensions were obtained from a long-axis
view by two-dimensional guided M-mode imaging. Outflow velocities were obtained by Doppler
sampling from an atypical 4- to 5-chamber view for measurement of the ejection time, as
described previously (1). LV ejection fraction (EF) was calculated as follows: EF = (LVEDD3 −
LVESD3)/LVEDD3, where LVEDD3 is LV end-diastolic diameter and LVESD3 is LV endsystolic diameter. The mean velocity of circumferential fiber shortening (Vcfc) was corrected for
heart rate as follows: Vcfc = SF/ETc, where SF is the shortening fraction obtained as SF =
(LVEDD − LVESD)/LVEDD and ETc is the ejection time divided by the square root of the heart
rate.
Left ventricular tissue preparation and subsequent RNA and protein extraction
2
Tritsch E. et al Supplementary material and methods and figures.
Control and SRFHKO 12 week-old mice mice were killed by cervical dislocation and hearts were
dissected immediately after sacrifice from at day 8, day 25 and day 50 after SRF inactivation,
respectively. To eliminate gender-related effects, exclusively male mice were used in our study.
Left ventricles were isolated and RNA was extracted with TRI reagent (SIGMA) according to
the manufacturer’s instructions and DNase treated by DNA-free Kit (Applied Biosystems)
according to the manufacturer’s instructions. Cardiac proteins were extracted in UTC buffer (8M
Urea, 2M Thiourea, 4% CHAPS, 50mM DTT, protease inhibitor cocktail (Sigma-Aldrich) or
RIPA buffer with antiprotease cocktail (Roche) and antiphosphatase reagents (2 mM EGTA, 3. 5
mM EDTA, 4.30 mM sodium fluoride, 5.40 mM b-glycerophosphate, pH 7.2 , 6. 20 mM sodium
pyrophosphate, 7. 1 mM sodium orthovanadate). RNA or proteins were homogenized by
Ultraturrax (IKA GmbH, cat. no. 3565000). In cell culture experiments, cells were scraped in
TRI reagent for RNA or RIPA buffer for proteins. For NCX1 Western blot, proteins were
denatured in Laemli buffer at 37°C for 30 minutes instead of the usual 5 minutes at 95°C to
avoid proteolysis.
RNA quality assessment
RNA integrity was analyzed using Agilent Bioanalyzer 6000 Nano Kit (cat. no. 5067-1511) for
total RNA and using the small RNA assay kit (cat. no. 5067-1548) for higher resolution in order
to detect microRNA abundance.
Q-RT-PCR and microRNA expression
To analyze microRNA abundance, 200 ng of RNA were reverse transcribed using miScript
Reverse Transcription Kit (Qiagen, Hilden, Germany). For mRNA abundance assessment, 1µg
of RNA was reverse transcribed using M-MuLV Reverse Transcriptase (Fermentas/ Thermo
Fisher Scientific, Burlington, Canada). Quantitative PCR was performed with LightCycler® 480
SYBR Green I Master (Roche, Basel, Switzerland) for mRNA and miScript SYBR Green PCR
Kit (Qiagen) for microRNA analysis. Oligos for mature MiR-1 and miR-16 were obtained from
Qiagen. We selected miR-16 as a reference gene because it showed minimal intergroup variance
and performed better than the snoRNA probes.
Oligos for qPCR were as follows: mouse primiR-1-1F: 5'-CCTGCTTGGGACACATACTTC-3'
and
primiR-1-1R:
5'-CAGTCTGGCGAGAGAGTTCC-3';
mouse
NCX1F:
GCTCTTGGAACCTCGGTGCCA, NCX1R : GACCAGGCCACGCCGATTCC, rat NCX1F:
GCCCCATTCTAGGCGAACACACC and NCX1R: TGTTGGTCCCCACCACGAGGG, rat
and mouse HprtF: 5'-AGGACCTCTCGAAGTGT-3',
HprtR: 5'-TTCAAATCCCTGAAGTACTCAT-3',
mouse
and
rat
SRF-F:
5’CACCTACCAGGTGTCGGAAT-3’, mouse SRF-R: 5’-GCTGTCTGGATTGTGGAGGT-3’, rat
SRF-R 5’-GCTGTTTGGATTGTGGAGGT-3’.
3
Tritsch E. et al Supplementary material and methods and figures.
Isolation, culture, and treatment of neonatal mouse and rat cardiac myocytes
1-day-old C57Bl6/N neonate mice were euthanized by decapitation and heart were isolated,
chopped and subsequently digested at 37°C under agitation in a cell stir for 10 minutes in 10 ml
of Liberase Blendzyme 4 in tyrode’s solution (Roche, 0.14 collagenase Wuensch units in 100 ml
tyrode) per digestion round. Released cells in liquid were collected after each round, centrifuged
at 900 rpm for 7 min and resuspended in 2 ml of medium (see below). After 8 digestion rounds,
resuspended cells were separated according to their type (cardiomyocytes, fibroblasts,
endothelium and cell debris). This was performed with the help of a density gradient in a 15 ml
falcon tube consisting of 3ml bottom percoll (Sigma-Aldrich; 13 parts of percoll stock+ 7 parts
of tyrode’s solution; percoll stock: 9 parts of percoll + 1 part of 10x thyrode’s solution), 4 ml top
percoll (Sigma-Aldrich, 9 parts of percoll stock + 11 parts of tyrode’s solution). The 16 ml of
resuspended cells were pooled, centrifuged for 5min at 900 rpm and resuspended in 4ml. ~2ml of
resuspended cells were pipetted above percoll gradient in 2 15ml-falcon tubes and centrifuged at
3000 rpm for 30 min. After centrifugation, the cardiomyocyte layer in the middle of the gradient
was collected, washed with medium and subsequently cultured for 24 hours in NRC medium,
that is, D-MEM without pyruvate (GIBCO, Invitrogen Ltd., Paisley, UK), supplemented with
penicillin (100 U/ml), streptomycin (100 μg/ml), 10% horse serum, and 5% fetal bovine serum
(FBS). 24 h prior to infection, medium was replaced by antibiotic free NRC medium. Neonatal
cells were cultured in a 1% CO2 incubator at 37°C.
Isolation of adult rat cardiomyocytes
Male Wistar rats (250–300 g) were subjected to anesthesia by intraperitoneal injection of
pentobarbital (100 mg/kg body weight) and hearts were excised rapidly. Individual adult rat
ventricular myocytes (ARVMs) were obtained by retrograde perfusion of the heart as previously
described (2). For enzymatic dissociation, the hearts were perfused retrogradly at a constant flow
of 6 ml/min at 37°C with a Ca2+-free Ringer solution containing (in mM) NaCl 117, KCl 5,
NaHCO3 4.4, KH2PO4 1.5, MgCl2 1.7, D-glucose 11.7, Na-phosphocreatine 10, taurine 20 and
HEPES 21, pH 7.1 during 5 min, followed by a perfusion at 4 ml/min for 1 h with the same
solution containing 1 mg/ml collagenase A (Boehringer Mannhein) and 300 µM EGTA and
CaCl2 to adjust free Ca2+ concentration to 20 µM. The ventricles were then separated from atria,
finely chopped and gently agitated to dissociate individual cells. The resulting cell suspension
was filtered on a gauze and the cells were allowed to settle down. The supernatant was discarded
and cells resuspended four more times with Ringer solution at increasing [Ca2+] from 20 µM to
300 µM. Freshly isolated cells were suspended in minimal essential medium (MEM: M 4780;
4
Tritsch E. et al Supplementary material and methods and figures.
Sigma) supplemented with 2.5% fetal bovine serum (FBS, Invitrogen), 1% penicillinstreptomycin, 20 mM HEPES (adjusted at pH 7.6) and plated on 35 mm, laminin-coated culture
dishes (10 μg/mL) at a density of 104 cells per dish.
Cell line culture
H9c2 cardiac cell line was a kind gift from Pr. Fischmeister´s research unit (INSERM U769,
Châtenay-Malabry). Cells are cultured in D-MEM (GIBCO, 4,5g glucose, with pyruvate)
supplemented with 10% FBS and antibiotics (see above). Cells were passed every 72h and used
up to passage 23. 48h Prior to transfection experiments, cells were seeded at a density of 75,000
cells / ml and their medium is replaced by antibiotics free medium 24 h prior to transfection.
Co-transfection and Dual-Luciferase Assay
PsiCHECKTM-2 vector, a kind gift from Dr. Polesskaya (CEA Saclay) contains a Renilla
luciferase reporter gene between the T7 promoter and the multiple cloning site reflecting
expression of the cloned DNA fragment and, in addition, a firefly luciferase gene at the vector
3’end generating a vector-internal normalization signal.
Transfection was performed according to the manufacturer’s instructions using lipofectamine
2000 reagent (Invitrogen) with duplicates for each experimental condition. Experiments were
repeated at least twice. Cells were co-transfected with 100 ng 3’UTR containing plasmid and
12.5 or 25 nM miR mimic (Applied Biosystems). After 24h, cells were harvested and luciferase
activities were measured with the Luciferase Dual-Reporter Kit (Promega). Renilla / Firefly ratio
represents normalized 3´UTR-reporter activity. Quantifications were done on the means of 2
independent experiments (n=4 for each condition).
MiR precursor, antimiR and Anxa5-miR-1 protector transfection
Newborn rat cardiac cells were cultured as described above and transfected 24 h after plating
with 25 nM for microRNA mimic (Applied Biosystems) and Anxa5-miR-1 protector (Exiquon,
designed sequence: GGAGGGAAGGGAATGTTT) or 75 nM microRNA power-inhibitor
(Exiqon) using lipofectamine RNAiMAX transfection agent as suggested by the manufacturer
(Invitrogen). 36 and 72 h after transfection, cells were harvested. RNA was extracted using RNA
NOW reagent (Biogentex, League City, TX); proteins were extracted in Urea buffer (s. a.).
Adenoviral constructions and infections
Anxa5 cDNA sequence with CMV constitutive promoter (Origene clone RG205619) was
amplified by PCR without the c-terminal GFP tag (replaced by a STOP codon) and inserted into
5
Tritsch E. et al Supplementary material and methods and figures.
Adeno-dsRED viral vector (Clontech) by Cre-assisted lox-P mediated recombination to obtain
Adeno-dsRED-Anxa5 construction. Neonatal cardiomyocytes were infected with each viral
construction at a MOI of 2 and 10 pfu/cell, respectively for 24 hours before renewal of the
medium and maintained at 37°C as described above prior to analysis.
Adult rat cardiomyocytes
After 1 h the medium was replaced by 300 μL of FBS-free MEM containing either an adenovirus
encoding Annexin A5 (Ad-Anxa5-dsRed) or DsRed only (Ad-dsRed), each at a MOI of 500
pfu/cell, and cells were maintained in a 95% O2, 5% CO2 atmosphere at 37 °C. All experiments
were performed 36 h-48 h after plating.
Cloning experiments
3´UTR cloning into psiCheck2 vector
3’ UTRs of potential miRNA target genes were PCR amplified with the following primers
comprising a XhoI and NotI site, respectively, at their 5’ end (shown in lower cases) :
Anxa5 3’UTR: fwd atgctcgagGAGCCGCCTGGAGCGCCCTG,
rev aatgcggccgcTGGAGGGAAGGGAATGTTTT;
NCX1 3’UTR: fwd atgctcgagAGACTGGGAGTAACCATTGCAAGGA,
rev aatgcggccgcTGGGTTTGGATTGTGGCTGTCTCC.
PCR was performed with phusion high fidelity polymerase (Finnzymes, Espoo, Finland) during
30 amplification cycles (annealing temperature 62°C, elongation time 1min 30). The obtained
double-stranded DNA fragment was introduced into the XhoI and NotI sites at the multiple
cloning site of the psiCHECKTM-2 Vector (Promega Corporation, Madison, WI). The
correctness of the 3’UTR inserts in the psiCheck vector was verified by sequencing (Beckmann
Coulter Genomics, Brea, CA).
Mutagenesis
Depletion of miR-1 seed sequence was carried out using Phusion Site-directed Mutagenesis Kit
(prod. no. F-541, Finnzymes) according to the manufacturer’s instructions. PCRs with
phosphorylated oligos for
Anxa5 mut miR-1: fwd CTTCCCTCCAGCGGCCG,
rev AATGTTTTGGATACTACCATCATAATTT;
6
Tritsch E. et al Supplementary material and methods and figures.
NCX1 mut miR-1: fwd AAAGCTGTGATTCTACTGATGGGAAATGG,
rev TGGGTTTATCTCTGCTCTTTGGTATTTTGA
Western Blot
Protein samples (~30µg) were fractioned by SDS-PAGE (4-10% Bis-Tris Mini Gels,
Invitrogen). Primary antibodies against Anxa5 (rabbit monoclonal, Origene, Rockville, MD),
and NCX1 (rabbit monoclonal, Swant, Switzerland) were used with anti-GAPDH (rabbit
polyclonal, Santa Cruz Biotechnology Inc., Santa Cruz, CA) as internal control. Incubation of
primary antibodies was performed in PBS, 5% milk at 4°C overnight followed washing with
PBS and incubation for 1 h at RT with HRP coupled secondary antibody. After ECL during 5
min (Thermo Scientific SuperSignal Wets Pico Chemiluminescent Substrate), protein signal was
acquired with LAS3000 image reader.
Measurements of Ca2+ transients and sarcomere shortening
Isolated cardiomyocytes were loaded with 5 µM Fura-2 AM (Invitrogen) at room temperature
for 15 min and then washed with external Ringer solution containing (in mM) NaCl 121.6, KCl
5.4, NaHCO3 4.013, NaH2PO4 0.8, Hepes 10, glucose 5, Na pyruvate 5, MgCl2 1.0, CaCl2 1.0,
pH 7.4. The loaded cells were field stimulated (5 V, 4 ms) at a frequency of 0.5 Hz. Sarcomere
length and Fura-2 ratio (measured at 512 nm upon excitation at 340 nm and 380 nm) were
simultaneously recorded using an IonOptix System (IonOptix, Milton, MA, USA).
Statistical analysis
We used two-way ANOVA for independent samples for comparisons between experimental
animal groups with or without treatment for gene expression data, followed by Tukey's HSD for
post-ANOVA comparisons. We used the Student’s unpaired t test for comparisons between 2
groups. The data shown are means  SEM. P-values of p<0.001 (***), p<0.01 (**) and p<0.05
(*) were considered statistically significant.
REFERENCES
1.
2.
Parlakian, A., Charvet, C., Escoubet, B., Mericskay, M., Molkentin, J.D., Gary-Bobo, G.,
De Windt, L.J., Ludosky, M.A., Paulin, D., Daegelen, D., et al. 2005. Temporally
controlled onset of dilated cardiomyopathy through disruption of the SRF gene in
adult heart. Circulation 112:2930-2939.
Rochais, F., Vandecasteele, G., Lefebvre, F., Lugnier, C., Lum, H., Mazet, J.L., Cooper,
D.M., and Fischmeister, R. 2004. Negative feedback exerted by cAMP-dependent
protein kinase and cAMP phosphodiesterase on subsarcolemmal cAMP signals in
intact cardiac myocytes: an in vivo study using adenovirus-mediated expression of
CNG channels. J Biol Chem 279:52095-52105.
7
Tritsch E. et al Supplementary material and methods and figures.
Supplementary Figure 1. Echocardiography analysis of cardiac parameters of control and
SRFHKO mice at baseline (D0), at D23 post-tamoxifen, and at D23 after PE treatment from
D10 to D23. Osmotic minipumps filled with phenylephrine (PE, 80 mg/kg/day) or vehicle buffer
(MOCK) were implanted at D10 and echocardiography were performed at D23, 2 days before
sacrifice. EF, LV ejection fraction. Vcfc, mean velocity of circumferential fiber shortening.
LVEDD, LV end-diastolic diameter. IVRT, isovolumic relaxation time. HR, average heart rate
during the complete echocardiography session. Hw/Bw, Heart weight to body weight ratio as
measured post-mortem immediately after sacrifice. N≥4 for each group. Data are expressed as
mean  S.E.M. ANOVA statitstics: (a) genotype effect, (b) treatment effect, (c) interaction. posthocTukey HSD test: *, p<0.05 D23 post-tam versus baseline same genotype; #, p<0.05 D23
post-tam PE versus mock same genotype.
8
Tritsch E. et al Supplementary material and methods and figures.
Supplementary Figure 2. Western blot analytsis of NCX1 expression at D8 after tamoxifen
injection in control and SRFHKO mutant mice. N=4 and N=5 for control and mutant group
respectively. Right panel: Quantification by Image J analysis. Expression levels are normalized
on GAPDH expression level and are given as fold change over mean control value  SEM.
9
Tritsch E. et al Supplementary material and methods and figures.
Supplementary Figure 3. Q-PCR analysis of miR-1 in NMC.
Q-PCR analysis for miR-1 expression in primary neonatal cardiomyocytes, transfected with
control siRNA or siRNA against SRF in presence of absence of miR-1 or antimiR-1 at indicated
concentrations. N=4 to 6 per group. Expression levels are normalized on miR-16 expression
level and are given as fold change over SiCtrl matched controls  SEM. **: p= 0,009. siSRF
versus siCtrl. p< 0,001 for all other groups versus siCtrl.
10
Tritsch E. et al Supplementary material and methods and figures.
Supplementary Figure 4. MiR-1 knock-down by antagomiR-1 leads to a modest induction
of NCX1 and AnxA5 expression.
(A-C), RT q-PCR analysis for miR-1 (A), NCX1 (B) and AnxA5 (C) and (D-E) Western-blot
analysis for NCX1 (D) and AnxA5 (E) in mice injected with control antagomiR (white bars) or
antagomiR-1 (gray bars). (N=4 for each group). Expression levels are normalized on Hprt for
RT-qPCR analyses and GAPDH expression level for Western-blot and given as fold change over
mean control value  SEM. * p<0.05, antagomiR-1 versus respective controls.
11