HEP06-0100-R
Llacuna et al,
1
SUPPLEMENTARY METHODS
Materials. Imipramine, NOE and pentoxifylline were obtained from Sigma (St. Louis,
MO). SP600125 and Smac/DIABLO antibody were from Calbiochem (Darmstadt,
Germany). Ac-DEVD-AMC, C12-NBD ceramide and cytochrome c oxidase antibody
were from Molecular Probes (Eugene, OR). Phospho-JNK, phospho-AKT, JNK and
AKT antibodies were from Cell Signaling (Beverly, MA). Bim, phospho-Bim, phosphoc-Jun and p65 antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA).
Active caspase-3 (clone C92-605) and cytochrome c (clone 7H8.2C12) antibodies were
from Pharmingen (BD Biosciences, San Jose, CA). The Hepa1c1c7 mouse hepatoma
cell line (European Collection of Animal Cell Cultures, Salisbury, Wilts, U.K.) was
grown in 10% FBS-supplemented DMEM.
Partial hepatic ischemia and treatments. For morphologic and biochemical
evaluation of tissue injury, we used a model of partial hepatic ischemia in mice. Briefly,
male wild-type mice (C57BL6, 8-12 weeks) were anesthesized using a vaporizer system
to deliver isoflurane/O2 inhalation. After a midline laparotomy, hepatic inflow to the
median and left lobes was occluded by application of a micro-vascular clamp (Biemer
clip, 0.29-0.39 N) for 90 min. Mesenteric venous congestion was prevented by portal
decompression through the right and caudate lobes. Reperfusion was initiated by
removing the clamp. Blood samples and liver biopsies were taken at different periods
after reperfusion for further evaluation. Control animals were sham operated. Animals
were pretreated 30 min prior to surgery with either a dose of NOE (100 mg/kg, Sigma),
imipramine (25 mg/kg, Sigma), SP600125 (20 mg/kg, Calbiochem) or with an equal
volume of the vehicle.
Total hepatic ischemia. Animal survival was determined using a model of total hepatic
ischemia in mice. Surgery was performed under isoflurane/O2 anesthesia as above.
1
HEP06-0100-R
Llacuna et al,
2
After a midline laparotomy, the portal triad was exposed and median and left liver lobes
were occluded for 60 min with a vascular clamp, preserving the perfusion of the
remaining liver and preventing mesenteric venous congestion during ischemia.
Immediately after reperfusion, the non-ischemic lobes (right and caudate) were ligated
with 3/0 sterile silk and resected leaving the ischemic lobes. Animals were monitored
every 12 hours during one week, and survival was calculated using the Kaplan-Meier
method.
Liver histology and TUNEL. After reperfusion the liver was fixed and sections (5 µm)
were stained with hematoxylin and eosin using standard methods. TUNEL staining was
performed using a commercial kit (In Situ Cell Death Detection Kit, POD from Roche),
examining the slides with a Zeiss Axioplan microscope equipped with a Nikon
DXM1200F digital camera. Serum ALT levels were measured by the Centro de
Diagnostico Medico (Hospital Clinic, Barcelona).
In vitro siRNA transfection and in vivo treatment. The program siRNA target finder
(Ambion), which follows the guidelines described by Elbashir et al (1), was used to
design specific siRNAs to downregulate ASMase. In addition, target sequences with
more than 16-17 contiguous base pairs of homology to other coding sequence were
eliminated from consideration, whereas appropriate controls to ensure the validity of the
data were included following design recommendations (2). Three siRNA sequences
targeting human ASMase mRNA (Gene BankTM Z14252), identified at positions
relative to the start codon:
271-291
(AAAGTCTTATTCACTGCTCTC) ASMase siRNA-1.
517-537
(AACATAGCACCACTAGATGTG) ASMase siRNA-2.
1491-1511
(AATAGATGGAAACTACCCCGG) ASMase siRNA-3.
2
HEP06-0100-R
Llacuna et al,
3
In addition, a negative control siRNA, without homology to any other gene, was
designed scrambling the nucleotide sequence of the ASMase siRNA-1, the siRNA with
higher efficacy to silence ASMase mRNA (not shown). The siRNAs were generated
following manufacturer´s recommendations with a transcription-based kit from Ambion
(SilencerTM siRNA construction kit),
For in vivo experiments, chemically synthesized siRNAs (Curevac, Tübingen,
Germany) were delivered into mice using the hydrodynamic transfection method by i.v.
injecting 1 nmols of scrambled or ASMase siRNAs in 1 ml of PBS into the tail vein 24
and 48 hours before surgery. This method, which has been proved effective to silence
liver proteins in vivo, delivers siRNAs to most of the mouse parenchymal cells (6070%). To discard interferon response in siRNA-treated animals, IL-12 serum levels
were measured after siRNA injection using an ELISA commercial kit (PeproTech EC,
London, UK). Poly I:C (Amersham, 2.5 mg/kg b.w.) was injected as a positive control
of IL-12 induction.
Real time PCR. Total RNA was isolated from mouse liver samples with the TRIzol
reagent (Invitrogen, Carlsbad, CA). Real-time PCR was performed using the iScript™
One-Step RT-PCR Kit with SYBR® Green (Bio-Rad, Hercules, CA) following the
manufacturer instructions. Threshold (CT) values for each mRNA were subtracted from
that of GAPDH mRNA, averaged and converted from log-linear to linear term. The
primer sequences used for GAPDH (Gene BankTM accession number M23599) and
ASMase (Gene BankTM accession number Z14252) amplification were as follows:
ASMase forward
5’- GTCAGCCGTCCATCTCTTTGA-3’;
ASMase reverse
5’-GGTCCCAGTGTAGATCAGTAA-3’;
GAPDH forward
5’-CGACCCCTTCATTGACCTCAA-3’;
GAPDH reverse
5’-CCTTCTCCATGGTGGTGAAGA-3’).
3
HEP06-0100-R
Llacuna et al,
4
SUPPLEMENTARY REFERENCES
1. Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T. Duplexes of
21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature
2001;411:494-498.
2. Editorial. Whitter RNAi? Nat Cell Biol 2003;5:489-490.
4